Team:ETH Zurich/Biology/MolecularMechanism

Circuit design

Circuit operations for SmoColi exposed to medium, low and zero xylene concentration resulting in a GFP band. Triangles indicating the gradient of AHL (blue) and sensor molecule (violet), receptively. Non active interactions and non expressed Proteins are indicated light colors.

SmoColi is a bacterio quantifier which can be activated with different signal, we implemented two of them acetaldehyde and xylene. The concentration gradient which is needed for SmoColi is either naturally or achieved by synthetic cellular degradation. For example in case of Xylene we included the upper Tol pathway of Pseudomonas putida in SmoColi [1]. In contrast acetaldeydhde is naturally degraded.

In our system we can use different small molceules as an activating input for the bandpass-filter [2]. The repressor which is activated by the small molecule is constantly expressed and enhances the expression of the LacI_M1 repressor (codon-modified LacI) and the lambda repressor CI, which are under control of the Xyl-Promotor, respectively. High xylene concentration results in high cytoplasmic levels of CI and of LacI_M1 and repression of the green fluorescent protein (GFP). Cells that are far from the input have low xylene concentrations, because of xylene degradation. Accordingly, LacI_M1 and CI are only expressed at basal level. Without repression of the lamda promoter wild-type LacI is produced and represses the production of GFP. At the same point the N-Acyl homoserine lactone (AHL) Synthase LuxI is produced, AHL binds to LuxR which is constantly expressed and represses the red fluorescent protein (RFP). AHL is a quorum-sensing molecule with a high diffusion rate, it diffuses through the whole tube and represses RFP production in the whole tube, even in cells where no AHL is produced.

Circuit operations for SmoColi exposed to very high xylene concentration resulting in an alarmsystem which turns the whole channel red. The triangle is indicating the sensor molecule concentration. Non active interactions and non expressed Proteins are indicated light colors.

If the xylene concentration is too high and it can not be degraded within the tube, no AHL is produced. Without AHL LuxR does not repress RFP and the whole tube turns red. To obtain better dynamics we tagged GFP and TetR with LVA tags.

Finally we can also use a negative input for our system, in this case we have to introduce an additional inverter to invert the negative input signal into a positive one. Therefore the tetracycline repressor protein (TetR) was used in case of AlcR. If acetalydeyhde is present AlcR binds to the promotor of TetR and inhibit its represssion, resulting in no TetR.

Plasmid design

Plasmid design for the AlcR system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [4].

Plasmid design for the XylR system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [4]. For a detailed description of the pCK04AxylR plasmid see [1].

For the biological implementation of the SmoColi system, we constructed a three-plasmid system with different antibiotic resistances. This setup was chosen in order to clone the whole SmoColi system into the same bacterial cells.

The vectors used in our setup are the parts pSB6A5, pSB3C5, pSB3K3 and pSB4K5. These plasmids contain different origins of replication, thus resulting in different copy numbers of the correlating plasmid in e.coli. pBR322, p15A and pSC101 origins are used as a stable three-plasmid system [3]. The copy number influences the amount of protein produced by the cell and plays a crucial role in our design, especially for the bandpass filter. Depending on the function of a particular protein in our system we had to evaluate on which plasmid the corresponding gene should be cloned.

In the xylene-responsive system we included an artificial degradation pathway (xylWCMABN) so that we could establish a xylene gradient. For this purpose the plasmid pCK04AxylR was added [1]. To avoid incompatibilities of plasmids we adapted the rest of our system and changed the composition of the genes on each vector compared to the AlcR system.

Cloning strategy

By cloning our parts we tried to stick as much as possible to the strategies proposed in the registry of standard biological parts [5].

• If available, genes and promoters in SmoColi were obtained from the iGEM spring 2011 distribution kit. A codon-optimized version of alcR and P_tet-lacI_M1 were synthesized. P_alc- and P_U-promoters were obtained by PCR.

• After isolation of the DNA, ribosome binding sites and prefix (5' gaattcgcggccgcttctagag 3') respectively suffix (5' tactagtagcggccgctgcag 3') were added to the gene by polymerase chain reaction. The PCR products were purified and afterwards digested with XbaI-PstI.

• Plasmid vectors containing the corresponding promoter were linearized by SpeI-PstI and the XbaI-PstI fragment containing the gene of interest was ligated into the backbone.

• In a next step we isolated a EcoRI-SpeI fragment with promoter, ribosome binding site and gene and inserted it into a EcoRI-XbaI cut vector containing a transcriptional terminator.

• In the end all the constructed parts were assembled on the corresponding vectors for the final SmoColi system. Some parts (especially lacI in an actively expressed form) appeared to be negatively selected by e.coli. So we had to assemble the parts in a way that lacI was always repressed.

Definition of ribosome binding sites

Another important role in the synthesis of proteins plays the ribosome binding site (RBS), where the ribosomes are bound to the mRNA at the initiation of the translation process. The ribosome binding sites which we included in our system were designed in several different ways:

• For the bandpass filter we adapted the ones which are also used for the plasmids in [2].

• For the other parts we either tried to use naturally ocurring ribosome binding sites or took specific ones from the community collection of RBS [6].

The strength of all the ribosome binding sites used was estimated with a RBS calculator [7]. Although the efficiency of protein synthesis is not directly proportional to the estimated values, they can still indicate whether a certain RBS is more or less strong.

References

[1] [http://aem.asm.org/cgi/content/abstract/64/2/748 Sven Panke, Juan M. Sánchez-Romero, and Víctor de Lorenzo: Engineering of Quasi-Natural Pseudomonas putida Strains for Toluene Metabolism through an ortho-Cleavage Degradation Pathway, Appl Environ Microbiol, February 1998, 64: 748-751]

[2] [http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html Subhayu Basu, Yoram Gerchman1, Cynthia H. Collins, Frances H. Arnold & Ron Weiss: A synthetic multicellular system for programmed pattern formation, Nature 2005, 434: 1130-11342]

[3] [http://www.springerlink.com/content/3fj1xxl9p42kx8l5/ Karl Friehs Plasmid Copy Number and Plasmid Stability, Advances in Biochemical Engineering/Biotechnology, 2004, 86: 22-192]

[4] [http://openwetware.org/wiki/Arking:JCAOligoTutorial8 OpenWetWare Arking:JCAOligoTutorial8, 0 Jul 2008, 04:32 UTC. 21 Sep 2011, 01:32]

[5] [http://partsregistry.org/Help:Contents Registry of Standard Biological Parts Help:contents 21 Sep 2011, 02:59]

[6] [http://partsregistry.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Community_Collection Registry of Standard Biological Parts Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection 21 Sep 2011, 08:49]

[7] []