Team:Columbia-Cooper/Project

From 2011.igem.org

(Difference between revisions)
Line 21: Line 21:
<img src="http://2011.igem.org/wiki/images/a/a3/BLUE_LIGHT_DIAGRAM_%281%29.png" width=960/>
<img src="http://2011.igem.org/wiki/images/a/a3/BLUE_LIGHT_DIAGRAM_%281%29.png" width=960/>
 +
 +
<h2>Goals and Strategies</h2>
 +
 +
<p>Our initial goal was to clone the nucleotide sequences of three small peptides, A7 (N-SLTPLTTSHLRS-C), Z8 (N-VISNHAESSRRL-C), and J140 ((N-TGCAACAACCCGATGCACCAGAACTGC-C) ,which have been previously reported in Mao, et. al. to nucleate zinc sulfide (A7 and Z8 peptides) and cadmium sulfide (J140 peptide) to form  quantum dot containing nano-wires using phage display.</p>
 +
 +
<p>Since all of the QD nucleating peptides were small sequences of 70 base pairs or less, we opted to generate the inserts using an oligonucleotide annealing procedure (see protocols) using designed oligos ordered from IDT. These were to be then cloned into the BioBrick vector PSB13C. Also, the sequence of the small peptide CDS7 (N-GDVHHHGRHGAEHADI-C), which previously demonstrated by Mi, et. al. to nucleate the formation of cadmium sulfide containing QDs, was synthesized by Invitrogen in a pANY vector and then amplified from the construct using primers containing either Biobrick ends conforming to RFC23 Silver lab standard or BamHI and NcoI restriction sites for cloning into the pET28 expression vector.</p>
 +
 +
<p>In addition to those four peptides, we identified an existing BioBrick part (Bba_K231000; Metal Binding Peptide) which we hypothesize to have the ability to nucleate Quantum Dots. We intend to further modify this part by adding additional restriction sites, BamHI and NcoI, internal to the BioBrick standard restriction sites in order that the part may be subcloned into the commercially available IPTG-inducible expression vector, pET28 and test it for this new application.</p>
 +
 +
<p>Third, we set out to create a device that would allow us to refine the biological QD manufacturing process to favor the production of uniform crystals of specific emission wavelengths. The device would consist of the Blue light promoter combined with a chloramphenicol resistance cassette.</p>
 +
 +
<p>Fourth, we would like to test the ability of the QD nucleating peptides to bind a wider range of less toxic metals such as zinc and selenium in order to expand their biocompatibility and lessen their environmental impact.</p>
 +
 +
<h2>Procedures</h2>
 +
 +
<h3>Oligo design for Quantum Dot nucleating peptides A7, Z8 and J140</h3>
 +
 +
<p>We utilized the “Gene Synthesis Optimization Program”, originally developed by the 2006 iGEM team from Davidson College (http://gcat.davidson.edu/IGEM06/oligo.html), to design a series of overlapping single stranded oligos for subsequent annealing reactions. For each sequence , the inserts to be annealed consisted of 4 overlapping oligos. The overlapping oligos were then annealed and ligated into a PSB1C3 vector digested with EcoR1 and Spe1 and gel purified.</p>
 +
 +
<p>The oligos used for the annealing reactions were as follows:</p>
 +
 +
<p>Oligos for peptide J140 (for Cd2S quantum dots)</p>
 +
 +
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p>
 +
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p>
 +
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p>
 +
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p>
 +
 +
<p>Oligos for peptide A7 (for ZnS quantum dots)</p>
 +
 +
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p>
 +
<p>43-mer 5'-TGGGCTGCAACAACCCGATGCACCAGAACTGCTAAGGATCCTA-3’</p>
 +
<p>40-mer 5'-CATCGGGTTGTTGCAGCCCATGGCTCTAGAAGCGGCCGCG-3’</p>
 +
<p>27-mer 5'-CTAGTAGGATCCTTAGCAGTTCTGGTG-3’</p>
 +
 +
<p>Oligos for peptide Z8 (for ZnS quantum dots)</p>
 +
 +
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p>
 +
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p>
 +
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p>
 +
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p>
 +
 +
<h3>Oligo annealing reactions</h3>
 +
<p>The oligos for the quantum dot nucleation peptide sequences were annealed using the <a href="http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts">Silver lab protocol</a>.</p>
 +
 +
<h3>Synthesis of quantum dot nucleating peptide sequence CDS7</h3>
 +
 +
<p>The CDS7 insert for ligation was synthesized by Invitrogen/Mr. Gene and cloned into the pANY vector. We amplified via PCR the CDS7 insert from the pANY vector. The PCR product was digested with EcoRI and PstI and ligated into the backbone plasmid PSB1C3.</p>
 +
 +
<p>The sequence of the synthesized CDS7 insert, containing RFC23 Silver lab standard BioBrick ends and NcoI and BamHI restriction sites is:</p>
 +
<p>5’-GAATTCGCGGCCGCTTCTAGAGCCATGGGCCATCATCATCATCATCACGGCGATGTGCATCATCATGGCCGCCACGGCGCGGAACATGCGGATATTTAAGGATCCTACTAGTAGCGGCCGCTGCAG-3’</p>
 +
 +
<h3>Ligations</h3>
 +
 +
<p>Ligations of QD binding peptide sequences into PSB1C3 and pET28 were performed using the protocol listed in the <a href="http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones">Registry of Standard Biological Parts</a>. In some case different enzymatic digestions were used for the appropriate vector, i.e BamHI and NcoI for the pET28 IPTG inducible expression vector. Ligated plasmids were sent out to GeneWiz for sequence confirmation.</p>
 +
</div>
</div>
</body>
</body>
</html>
</html>

Revision as of 01:34, 29 September 2011


Our Project

Abstract

We are using synthetic biology to build an eco-friendly system for making biologically produced quantum dots (QDs). While QDs can be manufactured through chemical processes, these processes are toxic, energy intensive, and yield dots that are challenging to use for promising biological applications. Furthermore, QDs created in this way are also thought to be more compatible with biological systems and require less energy to produce (Mi et. al.). The addition of QD manufacturing to the toolbox of synthetic biology can expand the horizons of existing isolated systems; for example, motility control and light responsiveness ( might couple with dot production to generate self assembling circuits.

In order to achieve this, our team’s primary goal was to engineer E. coli bacteria to express several different peptides which bind to and nucleate salts of heavy metals, thereby crystallizing them into QDs.

In addition, we have designed a novel sensor/feedback device in order to enable the production of QDs with more uniform emission wavelengths. Since the size of QDs is directly related to their light emission spectrum, the goal is to have E. coli produced QDs, while growing in the presence of long wave UV light, activate a light-sensitive promoter that is sensitive to the the emission spectrum of the required QD size. This promoter is coupled to the expression of an antibiotic resistance cassette. As an initial proof-of-principal, our device uses a gene encoding for chloramphenicol antibiotic resistance, placed under the control of a blue light sensitive promoter, which had been previously characterized by the 2009 iGEM team of K.U. Leuven. Thus, blue QD producing E. coli would stimulate the blue light promoter resulting in antibiotic resistance, allowing the survival of only the cells producing the desired wavelength of light.

Goals and Strategies

Our initial goal was to clone the nucleotide sequences of three small peptides, A7 (N-SLTPLTTSHLRS-C), Z8 (N-VISNHAESSRRL-C), and J140 ((N-TGCAACAACCCGATGCACCAGAACTGC-C) ,which have been previously reported in Mao, et. al. to nucleate zinc sulfide (A7 and Z8 peptides) and cadmium sulfide (J140 peptide) to form quantum dot containing nano-wires using phage display.

Since all of the QD nucleating peptides were small sequences of 70 base pairs or less, we opted to generate the inserts using an oligonucleotide annealing procedure (see protocols) using designed oligos ordered from IDT. These were to be then cloned into the BioBrick vector PSB13C. Also, the sequence of the small peptide CDS7 (N-GDVHHHGRHGAEHADI-C), which previously demonstrated by Mi, et. al. to nucleate the formation of cadmium sulfide containing QDs, was synthesized by Invitrogen in a pANY vector and then amplified from the construct using primers containing either Biobrick ends conforming to RFC23 Silver lab standard or BamHI and NcoI restriction sites for cloning into the pET28 expression vector.

In addition to those four peptides, we identified an existing BioBrick part (Bba_K231000; Metal Binding Peptide) which we hypothesize to have the ability to nucleate Quantum Dots. We intend to further modify this part by adding additional restriction sites, BamHI and NcoI, internal to the BioBrick standard restriction sites in order that the part may be subcloned into the commercially available IPTG-inducible expression vector, pET28 and test it for this new application.

Third, we set out to create a device that would allow us to refine the biological QD manufacturing process to favor the production of uniform crystals of specific emission wavelengths. The device would consist of the Blue light promoter combined with a chloramphenicol resistance cassette.

Fourth, we would like to test the ability of the QD nucleating peptides to bind a wider range of less toxic metals such as zinc and selenium in order to expand their biocompatibility and lessen their environmental impact.

Procedures

Oligo design for Quantum Dot nucleating peptides A7, Z8 and J140

We utilized the “Gene Synthesis Optimization Program”, originally developed by the 2006 iGEM team from Davidson College (http://gcat.davidson.edu/IGEM06/oligo.html), to design a series of overlapping single stranded oligos for subsequent annealing reactions. For each sequence , the inserts to be annealed consisted of 4 overlapping oligos. The overlapping oligos were then annealed and ligated into a PSB1C3 vector digested with EcoR1 and Spe1 and gel purified.

The oligos used for the annealing reactions were as follows:

Oligos for peptide J140 (for Cd2S quantum dots)

24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’

52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’

43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’

33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’

Oligos for peptide A7 (for ZnS quantum dots)

24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’

43-mer 5'-TGGGCTGCAACAACCCGATGCACCAGAACTGCTAAGGATCCTA-3’

40-mer 5'-CATCGGGTTGTTGCAGCCCATGGCTCTAGAAGCGGCCGCG-3’

27-mer 5'-CTAGTAGGATCCTTAGCAGTTCTGGTG-3’

Oligos for peptide Z8 (for ZnS quantum dots)

24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’

52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’

43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’

33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’

Oligo annealing reactions

The oligos for the quantum dot nucleation peptide sequences were annealed using the Silver lab protocol.

Synthesis of quantum dot nucleating peptide sequence CDS7

The CDS7 insert for ligation was synthesized by Invitrogen/Mr. Gene and cloned into the pANY vector. We amplified via PCR the CDS7 insert from the pANY vector. The PCR product was digested with EcoRI and PstI and ligated into the backbone plasmid PSB1C3.

The sequence of the synthesized CDS7 insert, containing RFC23 Silver lab standard BioBrick ends and NcoI and BamHI restriction sites is:

5’-GAATTCGCGGCCGCTTCTAGAGCCATGGGCCATCATCATCATCATCACGGCGATGTGCATCATCATGGCCGCCACGGCGCGGAACATGCGGATATTTAAGGATCCTACTAGTAGCGGCCGCTGCAG-3’

Ligations

Ligations of QD binding peptide sequences into PSB1C3 and pET28 were performed using the protocol listed in the Registry of Standard Biological Parts. In some case different enzymatic digestions were used for the appropriate vector, i.e BamHI and NcoI for the pET28 IPTG inducible expression vector. Ligated plasmids were sent out to GeneWiz for sequence confirmation.