http://2011.igem.org/wiki/index.php?title=Special:Contributions/Sung&feed=atom&limit=50&target=Sung&year=&month=2011.igem.org - User contributions [en]2024-03-28T09:21:13ZFrom 2011.igem.orgMediaWiki 1.16.0http://2011.igem.org/Team:Columbia-Cooper/ProjectTeam:Columbia-Cooper/Project2011-09-29T03:58:38Z<p>Sung: </p>
<hr />
<div>{{:Team:Columbia-Cooper/Templates/main}}<br />
<html><br />
<head><br />
<style><br />
a.project<br />
{<br />
background-image:url("https://static.igem.org/mediawiki/2011/d/d6/Projectcolor.png");<br />
}<br />
</style><br />
</head><br />
<body><br />
<h1>Our Project/Data</h1><br />
<div style="text-align:left"><br />
<h2>Abstract</h2><br />
<p>We are using synthetic biology to build an eco-friendly system for making biologically produced quantum dots (QDs). While QDs can be manufactured through chemical processes, these processes are toxic, energy intensive, and yield dots that are challenging to use for promising biological applications. Furthermore, QDs created in this way are also thought to be more compatible with biological systems and require less energy to produce (Mi et. al.).<br />
The addition of QD manufacturing to the toolbox of synthetic biology can expand the horizons of existing isolated systems; for example, motility control and light responsiveness ( might couple with dot production to generate self assembling circuits.</p><br />
<br />
<p>In order to achieve this, our team’s primary goal was to engineer E. coli bacteria to express several different peptides which bind to and nucleate salts of heavy metals, thereby crystallizing them into QDs.</p><br />
<br />
<p>In addition, we have designed a novel sensor/feedback device in order to enable the production of QDs with more uniform emission wavelengths. Since the size of QDs is directly related to their light emission spectrum, the goal is to have E. coli produced QDs, while growing in the presence of long wave UV light, activate a light-sensitive promoter that is sensitive to the the emission spectrum of the required QD size. This promoter is coupled to the expression of an antibiotic resistance cassette. As an initial proof-of-principal, our device uses a gene encoding for chloramphenicol antibiotic resistance, placed under the control of a blue light sensitive promoter, which had been <a href="https://2009.igem.org/Team:KULeuven/Design/Blue_Light_Receptor">previously characterized</a> by the 2009 iGEM team of K.U. Leuven. Thus, blue QD producing E. coli would stimulate the blue light promoter resulting in antibiotic resistance, allowing the survival of only the cells producing the desired wavelength of light.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2011/a/a3/BLUE_LIGHT_DIAGRAM_%281%29.png" width=960/><br />
<br />
<h2>Goals and Strategies</h2><br />
<br />
<p>Our initial goal was to clone the nucleotide sequences of three small peptides, A7 (N-SLTPLTTSHLRS-C), Z8 (N-VISNHAESSRRL-C), and J140 ((N-TGCAACAACCCGATGCACCAGAACTGC-C) ,which have been previously reported in Mao, et. al. to nucleate zinc sulfide (A7 and Z8 peptides) and cadmium sulfide (J140 peptide) to form quantum dot containing nano-wires using phage display.</p><br />
<br />
<p>Since all of the QD nucleating peptides were small sequences of 70 base pairs or less, we opted to generate the inserts using an oligonucleotide annealing procedure (see protocols) using designed oligos ordered from IDT. These were to be then cloned into the BioBrick vector PSB13C. Also, the sequence of the small peptide CDS7 (N-GDVHHHGRHGAEHADI-C), which previously demonstrated by Mi, et. al. to nucleate the formation of cadmium sulfide containing QDs, was synthesized by Invitrogen in a pANY vector and then amplified from the construct using primers containing either Biobrick ends conforming to RFC23 Silver lab standard or BamHI and NcoI restriction sites for cloning into the pET28 expression vector.</p><br />
<br />
<p>In addition to those four peptides, we identified an existing BioBrick part (Bba_K231000; Metal Binding Peptide) which we hypothesize to have the ability to nucleate Quantum Dots. We intend to further modify this part by adding additional restriction sites, BamHI and NcoI, internal to the BioBrick standard restriction sites in order that the part may be subcloned into the commercially available IPTG-inducible expression vector, pET28 and test it for this new application.</p><br />
<br />
<p>Third, we set out to create a device that would allow us to refine the biological QD manufacturing process to favor the production of uniform crystals of specific emission wavelengths. The device would consist of the Blue light promoter combined with a chloramphenicol resistance cassette.</p><br />
<br />
<p>Fourth, we would like to test the ability of the QD nucleating peptides to bind a wider range of less toxic metals such as zinc and selenium in order to expand their biocompatibility and lessen their environmental impact.</p><br />
<br />
<h2>Procedures</h2><br />
<br />
<h3>Oligo design for Quantum Dot nucleating peptides A7, Z8 and J140</h3><br />
<br />
<p>We utilized the “Gene Synthesis Optimization Program”, <a href="http://gcat.davidson.edu/IGEM06/oligo.html">originally developed</a> by the 2006 iGEM team from Davidson College, to design a series of overlapping single stranded oligos for subsequent annealing reactions. For each sequence , the inserts to be annealed consisted of 4 overlapping oligos. The overlapping oligos were then annealed and ligated into a PSB1C3 vector digested with EcoR1 and Spe1 and gel purified.</p><br />
<br />
<p>The oligos used for the annealing reactions were as follows:</p><br />
<br />
<p>Oligos for peptide J140 (for Cd2S quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p><br />
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p><br />
<br />
<p>Oligos for peptide A7 (for ZnS quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>43-mer 5'-TGGGCTGCAACAACCCGATGCACCAGAACTGCTAAGGATCCTA-3’</p><br />
<p>40-mer 5'-CATCGGGTTGTTGCAGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>27-mer 5'-CTAGTAGGATCCTTAGCAGTTCTGGTG-3’</p><br />
<br />
<p>Oligos for peptide Z8 (for ZnS quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p><br />
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p><br />
<br />
<h3>Oligo annealing reactions</h3><br />
<p>The oligos for the quantum dot nucleation peptide sequences were annealed using the <a href="http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts">Silver lab protocol</a>.</p><br />
<br />
<h3>Synthesis of quantum dot nucleating peptide sequence CDS7</h3><br />
<br />
<p>The CDS7 insert for ligation was synthesized by Invitrogen/Mr. Gene and cloned into the pANY vector. We amplified via PCR the CDS7 insert from the pANY vector using the following primers:</p> <br />
<p>Forward primer: 5’-CGATCGAGAATTCGCGGCCGCTTCTAGAGCCATCATCATCATCATCAC-3’</p><br />
<p>Reverse primer:<br />
5’-GCTATGCACTGCAGCGGCCGCTACTAGTTAAATATCCGCATGTTCCGC-3’</p><br />
<p>The PCR product was digested with EcoRI and PstI and ligated into the backbone plasmid PSB1C3. <br />
For cloning the CDS7 insert into the pET28 expression vector, both pET28 vector and PSB1C3 containing CDS7 were digested with BamHI.The digested pET28 vector was treated with antarctic phosphatase and then ligated to the PSB1C3 vector containing the CDS7 insert. Ligated constructs were generated that were approximately about 7Kb in length. This new construct was then digested with NcoI and the larger fragment, the pET28 backbone containing the CDS7 insert, was gel purified and then self-ligated.</p><br />
<p>The sequence of the synthesized CDS7 insert, containing RFC23 Silver lab standard BioBrick ends and NcoI and BamHI restriction sites is:</p><br />
<p>5’-GAATTCGCGGCCGCTTCTAGAGCCATGGGCCATCATCATCATCATCACGGCGATGTGCATCATCATGGCCGCCACGGCGCGGAACATGCGGATATTT... <br />
AAGGATCCTACTAGTAGCGGCCGCTGCAG-3’</p><br />
<br />
<br />
<h3>Ligations</h3><br />
<br />
<p>Ligations of QD binding peptide sequences into PSB1C3 and pET28 were performed using the protocol listed in the <a href="http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones">Registry of Standard Biological Parts</a>. In some case different enzymatic digestions were used for the appropriate vector, i.e BamHI and NcoI for the pET28 IPTG inducible expression vector. Ligated plasmids were sent out to GeneWiz for sequence confirmation.</p><br />
<br />
<h3>Transformations</h3><br />
<br />
<p>Transformations were performed using either NEB Turbo Competent E. coli cells and following the high efficiency transformation protocol recommended by the manufacturer or using fresh cultures of JM109 E. coli cells that had been made competent using the Fermentas TransformAid bacterial transformation kit and following the manufacturer’s recommended protocol.</p><br />
<br />
<h3>Quantum Dot Production in E. coli (Modified from Mi, et. al.)</h3><br />
<ol><br />
<li>Inoculate single colonies transformed with pET28-CDS7 into 1m of LB-Kanamycin media and incubate for 8 hours in a shaking incubator, set at 250 rpm, at 37 degrees Celcius until an O.D. 600 of ~1.0 was reached.</li><br />
<br />
<li>From the culture, re-inoculate 5 ml of LB-Kanamycin media to a starting optical density of 0.1 at 600 nm. </li><br />
<br />
<li>Incubate until mid-log phase is reached, O.D. 600 ~0.5, ~2 hours.</li><br />
<br />
<li>Add IPTG (formula weight.=238.3; add 0.0024 gms. per 20mls LB-Kan) to a final concentration of 0.5mM and cadmium chloride (formula weight.= 183.3; add 0.0037 gms per 20mls LB-Kan ) to a final concentration of 1mM. </li><br />
<br />
<li>Incubate in the shaker for an additional 3 hours.</li><br />
<br />
<li>Slowly add a freshly prepared solution of sodium sulfide (anhydrous formula weight.=78, nonahydrate formula weight.=240.2; we made a 100mM stock solution, 0.024 gms per ml for nonahydrate) into LB-Kan to a final concentration of 1mM.</li><br />
<br />
<li>Incubate at room temperature with slow “end-over-end” rotation for 1.5 hours.</li><br />
<br />
<li>Centrifuge and wash samples 3 times with distilled water and characterize with fluorescence spectrometry. (350nm excitation, 450nm emission for 1mM reagents, 510nm emission for 10mM reagents)</li><br />
</ol><br />
<h2>Blue light stimulated antibiotic resistance device</h2><br />
<br />
<p>Our new device consists of a blue light inducible promoter (part BBa_K28013) that had been previously characterized, driving the expression of a previously submitted chloramphenicol resistance gene (part BBa_P1004). When blue light is present, the device activates chloramphenicol resistance. This device was intended as a system for using antibiotic selection to generate quantum dots within a narrow range of wavelengths. Our submitted part uses the psB1A3 backbone as opposed to the psB1C3 backbone, since the device produces chloramphenicol resistance in the cells.</p><br />
<br />
<p>The blue light promoter is inhibited by native repressor ycgF. Without dimerizing with ycgE, ycgF will remain bound to the DNA and prevent transcription. When blue light is present, ycgF changes conformation and dimerizes with ycgE. Dimerized ycgF releases from the promoter region and no longer represses gene transcription of the chloramphenicol resistance gene.</p><br />
<br />
<p>The incubation protocol is as follows:</p><br />
<ol><br />
<li>Transformed E. coli samples containing the Blue light stimulated antibiotic resistance device and controls were incubated at 37 degrees Celsius, in a shaking incubator, irradiated in blue light. </li><br />
<li>The light induced samples were incubated in a foil lined container with 73 blue LEDs that were positioned approximately 2 cm above the sample tubes containing 1mL bacteria, 3.5ml LB broth and 5uL ampicillin.</li><br />
<li>The OD 600 reading was recorded for each sample at every hour. The dilution was 40uL sample and 160uL sterile water. 40uL Lb broth and 160uL water was used to zero the spectrophotometer.</li><br />
<li>After the first hour of growth 5uL of chlorophenicol was added to each<br />
sample. Another 5uL was added to each sample after the 3 hour mark to<br />
ensure that there was a sufficiently high concentration of chlorophenicol within all samples.</li><br />
</ol><br />
<br />
<h2>Results</h2><br />
<h3>QD nucleation experiments performed with CDS7 peptide in pET28b</h3><br />
<p>Bacterial cells from two colonies resulting from a transformation of JM109 with pET28-CDS7 were compared to pET28 alone for their ability to nucleate QDs.</p><br />
<p>5 mL cultures were inoculated to OD600 0.1 and grown at 37C w/shaking @225 until OD600 reached 0.5 at which time the synthesis of the peptide was induced with IPTG 0.5mM. In three separate experiments, cells were either immediately treated with 1mM or 10mM CdCl or they were allowed to incubate with the IPTG for 2h prior to addition of CdCl. Following CdCl addition the cells were incubated for 3h. They were then removed from the 37C shaker and sodium sulfide added slowly to 1mM. The tubes were placed on a rotator at room temperature for 1.5 h, after which the cells were washed 4x with 10mL volumes of distilled water and analyzed via fluorescence microscopy with UV excitation. The sole variable determining fluorescence intensity appeared to be the CdCl treatment. Cells containing vector with no CDS7 insert appeared as bright to the eye as those engineered to produce CDS7. In addition, the presence or absence of IPTG did not appear to affect the intensity. We intend to pursue further experiments since it cannot as yet be determined if there was a flaw in our QD manufacturing procedure, an inadequately sensitive measuring system, or whether the report of CDS7’s capabilities in the literature was erroneous.</p><br />
<br />
<h3>Blue promoter verified</h3><br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2011/1/19/CUResults1.png" width=960/><br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2011/2/29/Results2CU.png" width=960/><br />
<br /><br />
<h3>400x UV Fluorescence Images of Bacteria</h3><br />
<br /><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/9/9d/Captured_40x_1.jpg)"></div><br />
<div class="picinfo" style="background-image:url(https://static.igem.org/mediawiki/2011/5/54/Captured_40x_2.jpg)"></div><br />
</div><br />
<br />
<h3>Video of Engineered Bacteria</h3><br />
<iframe src="http://player.vimeo.com/video/29759009?portrait=0&amp;color=01AAEA" width="400" height="300" frameborder="0" webkitAllowFullScreen allowFullScreen></iframe><br />
<br />
<h2>References</h2><br />
<br />
<p>Biosynthesis and characterization of CdS quantum dots in genetically engineered<br />
Escherichia coli. Congcong Mi, Yanyan Wang, Jingpu Zhang, Huaiqing Huang, Linru Xu, Shuo <br />
Wang, Xuexun Fang, Jin Fang, Chuanbin Mao, Shukun Xu. Journal of Biotechnology. 153 (2011) 125-132.</p><br />
<br />
<p>Viral assembly of oriented quantum dot nanowires. Chuanbin Mao, Christine E. Flynn, Andrew Hayhurst, Rozamond Sweeney, Jifa Qi, George Georgiou,<br />
Brent Iverson, and Angela M. Belcher. PNAS. 100:12 (2003) 6946-6951.</p><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<h3>Parts submitted by our team!</h3><br />
<groupparts>iGEM011 Columbia-Cooper</groupparts></div>Sunghttp://2011.igem.org/Team:Columbia-Cooper/ProjectTeam:Columbia-Cooper/Project2011-09-29T03:26:37Z<p>Sung: </p>
<hr />
<div>{{:Team:Columbia-Cooper/Templates/main}}<br />
<html><br />
<head><br />
<style><br />
a.project<br />
{<br />
background-image:url("https://static.igem.org/mediawiki/2011/d/d6/Projectcolor.png");<br />
}<br />
</style><br />
</head><br />
<body><br />
<h1>Our Project</h1><br />
<div style="text-align:left"><br />
<h2>Abstract</h2><br />
<p>We are using synthetic biology to build an eco-friendly system for making biologically produced quantum dots (QDs). While QDs can be manufactured through chemical processes, these processes are toxic, energy intensive, and yield dots that are challenging to use for promising biological applications. Furthermore, QDs created in this way are also thought to be more compatible with biological systems and require less energy to produce (Mi et. al.).<br />
The addition of QD manufacturing to the toolbox of synthetic biology can expand the horizons of existing isolated systems; for example, motility control and light responsiveness ( might couple with dot production to generate self assembling circuits.</p><br />
<br />
<p>In order to achieve this, our team’s primary goal was to engineer E. coli bacteria to express several different peptides which bind to and nucleate salts of heavy metals, thereby crystallizing them into QDs.</p><br />
<br />
<p>In addition, we have designed a novel sensor/feedback device in order to enable the production of QDs with more uniform emission wavelengths. Since the size of QDs is directly related to their light emission spectrum, the goal is to have E. coli produced QDs, while growing in the presence of long wave UV light, activate a light-sensitive promoter that is sensitive to the the emission spectrum of the required QD size. This promoter is coupled to the expression of an antibiotic resistance cassette. As an initial proof-of-principal, our device uses a gene encoding for chloramphenicol antibiotic resistance, placed under the control of a blue light sensitive promoter, which had been <a href="https://2009.igem.org/Team:KULeuven/Design/Blue_Light_Receptor">previously characterized</a> by the 2009 iGEM team of K.U. Leuven. Thus, blue QD producing E. coli would stimulate the blue light promoter resulting in antibiotic resistance, allowing the survival of only the cells producing the desired wavelength of light.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2011/a/a3/BLUE_LIGHT_DIAGRAM_%281%29.png" width=960/><br />
<br />
<h2>Goals and Strategies</h2><br />
<br />
<p>Our initial goal was to clone the nucleotide sequences of three small peptides, A7 (N-SLTPLTTSHLRS-C), Z8 (N-VISNHAESSRRL-C), and J140 ((N-TGCAACAACCCGATGCACCAGAACTGC-C) ,which have been previously reported in Mao, et. al. to nucleate zinc sulfide (A7 and Z8 peptides) and cadmium sulfide (J140 peptide) to form quantum dot containing nano-wires using phage display.</p><br />
<br />
<p>Since all of the QD nucleating peptides were small sequences of 70 base pairs or less, we opted to generate the inserts using an oligonucleotide annealing procedure (see protocols) using designed oligos ordered from IDT. These were to be then cloned into the BioBrick vector PSB13C. Also, the sequence of the small peptide CDS7 (N-GDVHHHGRHGAEHADI-C), which previously demonstrated by Mi, et. al. to nucleate the formation of cadmium sulfide containing QDs, was synthesized by Invitrogen in a pANY vector and then amplified from the construct using primers containing either Biobrick ends conforming to RFC23 Silver lab standard or BamHI and NcoI restriction sites for cloning into the pET28 expression vector.</p><br />
<br />
<p>In addition to those four peptides, we identified an existing BioBrick part (Bba_K231000; Metal Binding Peptide) which we hypothesize to have the ability to nucleate Quantum Dots. We intend to further modify this part by adding additional restriction sites, BamHI and NcoI, internal to the BioBrick standard restriction sites in order that the part may be subcloned into the commercially available IPTG-inducible expression vector, pET28 and test it for this new application.</p><br />
<br />
<p>Third, we set out to create a device that would allow us to refine the biological QD manufacturing process to favor the production of uniform crystals of specific emission wavelengths. The device would consist of the Blue light promoter combined with a chloramphenicol resistance cassette.</p><br />
<br />
<p>Fourth, we would like to test the ability of the QD nucleating peptides to bind a wider range of less toxic metals such as zinc and selenium in order to expand their biocompatibility and lessen their environmental impact.</p><br />
<br />
<h2>Procedures</h2><br />
<br />
<h3>Oligo design for Quantum Dot nucleating peptides A7, Z8 and J140</h3><br />
<br />
<p>We utilized the “Gene Synthesis Optimization Program”, <a href="http://gcat.davidson.edu/IGEM06/oligo.html">originally developed</a> by the 2006 iGEM team from Davidson College, to design a series of overlapping single stranded oligos for subsequent annealing reactions. For each sequence , the inserts to be annealed consisted of 4 overlapping oligos. The overlapping oligos were then annealed and ligated into a PSB1C3 vector digested with EcoR1 and Spe1 and gel purified.</p><br />
<br />
<p>The oligos used for the annealing reactions were as follows:</p><br />
<br />
<p>Oligos for peptide J140 (for Cd2S quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p><br />
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p><br />
<br />
<p>Oligos for peptide A7 (for ZnS quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>43-mer 5'-TGGGCTGCAACAACCCGATGCACCAGAACTGCTAAGGATCCTA-3’</p><br />
<p>40-mer 5'-CATCGGGTTGTTGCAGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>27-mer 5'-CTAGTAGGATCCTTAGCAGTTCTGGTG-3’</p><br />
<br />
<p>Oligos for peptide Z8 (for ZnS quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p><br />
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p><br />
<br />
<h3>Oligo annealing reactions</h3><br />
<p>The oligos for the quantum dot nucleation peptide sequences were annealed using the <a href="http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts">Silver lab protocol</a>.</p><br />
<br />
<h3>Synthesis of quantum dot nucleating peptide sequence CDS7</h3><br />
<br />
<p>The CDS7 insert for ligation was synthesized by Invitrogen/Mr. Gene and cloned into the pANY vector. We amplified via PCR the CDS7 insert from the pANY vector using the following primers:</p> <br />
<p>Forward primer: 5’-CGATCGAGAATTCGCGGCCGCTTCTAGAGCCATCATCATCATCATCAC-3’</p><br />
<p>Reverse primer:<br />
5’-GCTATGCACTGCAGCGGCCGCTACTAGTTAAATATCCGCATGTTCCGC-3’</p><br />
<p>The PCR product was digested with EcoRI and PstI and ligated into the backbone plasmid PSB1C3. <br />
For cloning the CDS7 insert into the pET28 expression vector, both pET28 vector and PSB1C3 containing CDS7 were digested with BamHI.The digested pET28 vector was treated with antarctic phosphatase and then ligated to the PSB1C3 vector containing the CDS7 insert. Ligated constructs were generated that were approximately about 7Kb in length. This new construct was then digested with NcoI and the larger fragment, the pET28 backbone containing the CDS7 insert, was gel purified and then self-ligated.</p><br />
<p>The sequence of the synthesized CDS7 insert, containing RFC23 Silver lab standard BioBrick ends and NcoI and BamHI restriction sites is:</p><br />
<p>5’-GAATTCGCGGCCGCTTCTAGAGCCATGGGCCATCATCATCATCATCACGGCGATGTGCATCATCATGGCCGCCACGGCGCGGAACATGCGGATATTT... <br />
AAGGATCCTACTAGTAGCGGCCGCTGCAG-3’</p><br />
<br />
<br />
<h3>Ligations</h3><br />
<br />
<p>Ligations of QD binding peptide sequences into PSB1C3 and pET28 were performed using the protocol listed in the <a href="http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones">Registry of Standard Biological Parts</a>. In some case different enzymatic digestions were used for the appropriate vector, i.e BamHI and NcoI for the pET28 IPTG inducible expression vector. Ligated plasmids were sent out to GeneWiz for sequence confirmation.</p><br />
<br />
<h3>Transformations</h3><br />
<br />
<p>Transformations were performed using either NEB Turbo Competent E. coli cells and following the high efficiency transformation protocol recommended by the manufacturer or using fresh cultures of JM109 E. coli cells that had been made competent using the Fermentas TransformAid bacterial transformation kit and following the manufacturer’s recommended protocol.</p><br />
<br />
<h3>Quantum Dot Production in E. coli (Modified from Mi, et. al.)</h3><br />
<ol><br />
<li>Inoculate single colonies transformed with pET28-CDS7 into 1m of LB-Kanamycin media and incubate for 8 hours in a shaking incubator, set at 250 rpm, at 37 degrees Celcius until an O.D. 600 of ~1.0 was reached.</li><br />
<br />
<li>From the culture, re-inoculate 5 ml of LB-Kanamycin media to a starting optical density of 0.1 at 600 nm. </li><br />
<br />
<li>Incubate until mid-log phase is reached, O.D. 600 ~0.5, ~2 hours.</li><br />
<br />
<li>Add IPTG (formula weight.=238.3; add 0.0024 gms. per 20mls LB-Kan) to a final concentration of 0.5mM and cadmium chloride (formula weight.= 183.3; add 0.0037 gms per 20mls LB-Kan ) to a final concentration of 1mM. </li><br />
<br />
<li>Incubate in the shaker for an additional 3 hours.</li><br />
<br />
<li>Slowly add a freshly prepared solution of sodium sulfide (anhydrous formula weight.=78, nonahydrate formula weight.=240.2; we made a 100mM stock solution, 0.024 gms per ml for nonahydrate) into LB-Kan to a final concentration of 1mM.</li><br />
<br />
<li>Incubate at room temperature with slow “end-over-end” rotation for 1.5 hours.</li><br />
<br />
<li>Centrifuge and wash samples 3 times with distilled water and characterize with fluorescence spectrometry. (350nm excitation, 450nm emission for 1mM reagents, 510nm emission for 10mM reagents)</li><br />
</ol><br />
<h2>Blue light stimulated antibiotic resistance device</h2><br />
<br />
<p>Our new device consists of a blue light inducible promoter (part BBa_K28013) that had been previously characterized, driving the expression of a previously submitted chloramphenicol resistance gene (part BBa_P1004). When blue light is present, the device activates chloramphenicol resistance. This device was intended as a system for using antibiotic selection to generate quantum dots within a narrow range of wavelengths. Our submitted part uses the psB1A3 backbone as opposed to the psB1C3 backbone, since the device produces chloramphenicol resistance in the cells.</p><br />
<br />
<p>The blue light promoter is inhibited by native repressor ycgF. Without dimerizing with ycgE, ycgF will remain bound to the DNA and prevent transcription. When blue light is present, ycgF changes conformation and dimerizes with ycgE. Dimerized ycgF releases from the promoter region and no longer represses gene transcription of the chloramphenicol resistance gene.</p><br />
<br />
<p>The incubation protocol is as follows:</p><br />
<ol><br />
<li>Transformed E. coli samples containing the Blue light stimulated antibiotic resistance device and controls were incubated at 37 degrees Celsius, in a shaking incubator, irradiated in blue light. </li><br />
<li>The light induced samples were incubated in a foil lined container with 73 blue LEDs that were positioned approximately 2 cm above the sample tubes containing 1mL bacteria, 3.5ml LB broth and 5uL ampicilin.</li><br />
<li>The OD 600 reading was recorded for each sample at every hour. The dilution was 40uL sample and 160uL sterile wate. 40uL Lb broth and 160uL water was used to zero the spectrophotometer.</li><br />
<li>After the first hour of growth 5uL of chlorophenicol was added to each<br />
sample. Another 5uL was added to each sample after the 3 hour mark to<br />
ensure that there was a sufficiently high concentration of chlorophenicol within all samples.</li><br />
</ol><br />
<br />
<h2>References</h2><br />
<br />
<p>Biosynthesis and characterization of CdS quantum dots in genetically engineered<br />
Escherichia coli. Congcong Mi, Yanyan Wang, Jingpu Zhang, Huaiqing Huang, Linru Xu, Shuo <br />
Wang, Xuexun Fang, Jin Fang, Chuanbin Mao, Shukun Xu. Journal of Biotechnology. 153 (2011) 125-132.</p><br />
<br />
<p>Viral assembly of oriented quantum dot nanowires. Chuanbin Mao, Christine E. Flynn, Andrew Hayhurst, Rozamond Sweeney, Jifa Qi, George Georgiou,<br />
Brent Iverson, and Angela M. Belcher. PNAS. 100:12 (2003) 6946-6951.</p><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<h3>Parts submitted by our team!</h3><br />
<groupparts>iGEM011 Columbia-Cooper</groupparts></div>Sunghttp://2011.igem.org/Team:Columbia-Cooper/AttributionTeam:Columbia-Cooper/Attribution2011-09-29T03:11:45Z<p>Sung: </p>
<hr />
<div>{{:Team:Columbia-Cooper/Templates/main}}<br />
<html><br />
<head><br />
<style><br />
a.attribution<br />
{<br />
background-image:url("https://static.igem.org/mediawiki/2011/0/05/Attributioncolor.png");<br />
}<br />
</style><br />
</head><br />
<body><br />
<h1>Attribution</h1><br />
<div style="text-align:left"><br />
<p>The following people formed The Cooper Union lab group, advised by David Orbach and Dionne Lutz:</p><br />
<ul><br />
<li>Alison Acevedo</li><br />
<li>Christina Eng</li><br />
<li>Renxuan Liu</li><br />
<li>Thomas Bernstein</li><br />
<li>Donggyoon Hong</li><br />
<li>David Isele</li><br />
</ul><br />
<p>This group was responsible for the design, construction and testing of the composite part that was the feedback system. In addition, both groups participated in the manufacture of chemical quantum dots.</p><br />
<br />
<p>The following people formed the Columbia/NYU/High-School lab group, advised by Ellen Jorgensen and Oliver Medvedik:</p><br />
<ul><br />
<li>Christopher Lin</li><br />
<li>Matt Piziak</li><br />
<li>Sung Won Lim</li><br />
<li>Rikki Frenkel</li><br />
<li>Justin Fabrikant</li><br />
<li>Will Long</li><br />
<li>Min-Gyu Kim</li><br />
</ul><br />
<p>This group was responsible for the biobricking and expression of the metal binding peptides in E.coli and production of quantum dots. </p><br />
<p>The following people helped in conceptual and thematic design, as well as project development, advised by David Benjamin:</p><br />
<ul><br />
<li>Nathan Smith</li><br />
<li>Jayson Walker</li><br />
<li>Justin Fabrikant</li><br />
<li>Rikki Frenkel</li><br />
</ul><br />
<p>The following people formed the wiki design and program group:</p><br />
<ul><br />
<li>Matt Piziak</li><br />
<li>Christopher Lin</li><br />
<li>Christina Eng</li><br />
<li>Justin Fabrikant</li><br />
<li>Rikki Frenkel</li><br />
</ul><br />
<p>Special thanks to Eric Lima, Robert Uglesich, and David Wootton for your patience, ideas, and lab space.<p><br />
<p>Primers and Oligos designed by students and synthesized by IDT.</p><br />
<p>CDS7 coding sequence synthesized by Mr. Gene.</p><br />
<p>Nucleotide sequencing by GENEWIZ.</p><br />
<p>Unless otherwise noted, all work was performed by students. Any graduate students on the team are pursuing degrees unrelated to the biological sciences. </p><br />
<br />
<h3>The iGEM effort could not have happened without generous support and donation from following sponsors:</h3><br />
<ul><br />
<li>New England Bio Labs - reagents and supplies</li><br />
<li>Biomatters ltd - Geneious licenses for all students</li><br />
<li>Allan Kuchinsky - Generous donation for registration of a student</li><br />
</ul><br />
<br />
</div><br />
</body><br />
</html></div>Sunghttp://2011.igem.org/Team:Columbia-Cooper/ProjectTeam:Columbia-Cooper/Project2011-09-29T01:42:26Z<p>Sung: </p>
<hr />
<div>{{:Team:Columbia-Cooper/Templates/main}}<br />
<html><br />
<head><br />
<style><br />
a.project<br />
{<br />
background-image:url("https://static.igem.org/mediawiki/2011/d/d6/Projectcolor.png");<br />
}<br />
</style><br />
</head><br />
<body><br />
<h1>Our Project</h1><br />
<div style="text-align:left"><br />
<h2>Abstract</h2><br />
<p>We are using synthetic biology to build an eco-friendly system for making biologically produced quantum dots (QDs). While QDs can be manufactured through chemical processes, these processes are toxic, energy intensive, and yield dots that are challenging to use for promising biological applications. Furthermore, QDs created in this way are also thought to be more compatible with biological systems and require less energy to produce (Mi et. al.).<br />
The addition of QD manufacturing to the toolbox of synthetic biology can expand the horizons of existing isolated systems; for example, motility control and light responsiveness ( might couple with dot production to generate self assembling circuits.</p><br />
<br />
<p>In order to achieve this, our team’s primary goal was to engineer E. coli bacteria to express several different peptides which bind to and nucleate salts of heavy metals, thereby crystallizing them into QDs.</p><br />
<br />
<p>In addition, we have designed a novel sensor/feedback device in order to enable the production of QDs with more uniform emission wavelengths. Since the size of QDs is directly related to their light emission spectrum, the goal is to have E. coli produced QDs, while growing in the presence of long wave UV light, activate a light-sensitive promoter that is sensitive to the the emission spectrum of the required QD size. This promoter is coupled to the expression of an antibiotic resistance cassette. As an initial proof-of-principal, our device uses a gene encoding for chloramphenicol antibiotic resistance, placed under the control of a blue light sensitive promoter, which had been <a href="https://2009.igem.org/Team:KULeuven/Design/Blue_Light_Receptor">previously characterized</a> by the 2009 iGEM team of K.U. Leuven. Thus, blue QD producing E. coli would stimulate the blue light promoter resulting in antibiotic resistance, allowing the survival of only the cells producing the desired wavelength of light.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2011/a/a3/BLUE_LIGHT_DIAGRAM_%281%29.png" width=960/><br />
<br />
<h2>Goals and Strategies</h2><br />
<br />
<p>Our initial goal was to clone the nucleotide sequences of three small peptides, A7 (N-SLTPLTTSHLRS-C), Z8 (N-VISNHAESSRRL-C), and J140 ((N-TGCAACAACCCGATGCACCAGAACTGC-C) ,which have been previously reported in Mao, et. al. to nucleate zinc sulfide (A7 and Z8 peptides) and cadmium sulfide (J140 peptide) to form quantum dot containing nano-wires using phage display.</p><br />
<br />
<p>Since all of the QD nucleating peptides were small sequences of 70 base pairs or less, we opted to generate the inserts using an oligonucleotide annealing procedure (see protocols) using designed oligos ordered from IDT. These were to be then cloned into the BioBrick vector PSB13C. Also, the sequence of the small peptide CDS7 (N-GDVHHHGRHGAEHADI-C), which previously demonstrated by Mi, et. al. to nucleate the formation of cadmium sulfide containing QDs, was synthesized by Invitrogen in a pANY vector and then amplified from the construct using primers containing either Biobrick ends conforming to RFC23 Silver lab standard or BamHI and NcoI restriction sites for cloning into the pET28 expression vector.</p><br />
<br />
<p>In addition to those four peptides, we identified an existing BioBrick part (Bba_K231000; Metal Binding Peptide) which we hypothesize to have the ability to nucleate Quantum Dots. We intend to further modify this part by adding additional restriction sites, BamHI and NcoI, internal to the BioBrick standard restriction sites in order that the part may be subcloned into the commercially available IPTG-inducible expression vector, pET28 and test it for this new application.</p><br />
<br />
<p>Third, we set out to create a device that would allow us to refine the biological QD manufacturing process to favor the production of uniform crystals of specific emission wavelengths. The device would consist of the Blue light promoter combined with a chloramphenicol resistance cassette.</p><br />
<br />
<p>Fourth, we would like to test the ability of the QD nucleating peptides to bind a wider range of less toxic metals such as zinc and selenium in order to expand their biocompatibility and lessen their environmental impact.</p><br />
<br />
<h2>Procedures</h2><br />
<br />
<h3>Oligo design for Quantum Dot nucleating peptides A7, Z8 and J140</h3><br />
<br />
<p>We utilized the “Gene Synthesis Optimization Program”, <a href="http://gcat.davidson.edu/IGEM06/oligo.html">originally developed</a> by the 2006 iGEM team from Davidson College, to design a series of overlapping single stranded oligos for subsequent annealing reactions. For each sequence , the inserts to be annealed consisted of 4 overlapping oligos. The overlapping oligos were then annealed and ligated into a PSB1C3 vector digested with EcoR1 and Spe1 and gel purified.</p><br />
<br />
<p>The oligos used for the annealing reactions were as follows:</p><br />
<br />
<p>Oligos for peptide J140 (for Cd2S quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p><br />
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p><br />
<br />
<p>Oligos for peptide A7 (for ZnS quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>43-mer 5'-TGGGCTGCAACAACCCGATGCACCAGAACTGCTAAGGATCCTA-3’</p><br />
<p>40-mer 5'-CATCGGGTTGTTGCAGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>27-mer 5'-CTAGTAGGATCCTTAGCAGTTCTGGTG-3’</p><br />
<br />
<p>Oligos for peptide Z8 (for ZnS quantum dots)</p><br />
<br />
<p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p><br />
<p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p><br />
<p>43-mer 5'-CGCGTGGTTAGAGATAACGCCCATGGCTCTAGAAGCGGCCGCG-3’</p><br />
<p>33-mer 5'-CTAGTAGGATCCTTACAGACGACGAGAAGATTC-3’</p><br />
<br />
<h3>Oligo annealing reactions</h3><br />
<p>The oligos for the quantum dot nucleation peptide sequences were annealed using the <a href="http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts">Silver lab protocol</a>.</p><br />
<br />
<h3>Synthesis of quantum dot nucleating peptide sequence CDS7</h3><br />
<br />
<p>The CDS7 insert for ligation was synthesized by Invitrogen/Mr. Gene and cloned into the pANY vector. We amplified via PCR the CDS7 insert from the pANY vector. The PCR product was digested with EcoRI and PstI and ligated into the backbone plasmid PSB1C3.</p><br />
<br />
<p>The sequence of the synthesized CDS7 insert, containing RFC23 Silver lab standard BioBrick ends and NcoI and BamHI restriction sites is:</p><br />
<p>5’-GAATTCGCGGCCGCTTCTAGAGCCATGGGCCATCATCATCATCATCACGGCGATGTGCATCATCATGGCCGCCACGGCGCGGAACATGCGGATA...<br />
TTTAAGGATCCTACTAGTAGCGGCCGCTGCAG-3’</p><br />
<br />
<p>The sequence of the synthesized CDS7 primer with only the RFC23 Silver lab standard BioBrick overhangs is:</p><br />
<br />
<p>Forward:5'CGATCGAGAATTCGCGGCCGCTTCTAGAGCCATCATCATCATCATCAC'3</p><br />
<br />
<p>Reverse:5'GCTATGCACTGCAGCGGCCGCTACTAGTTAAATATCCGCATGTTCCGC'3</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Ligations</h3><br />
<br />
<p>Ligations of QD binding peptide sequences into PSB1C3 and pET28 were performed using the protocol listed in the <a href="http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones">Registry of Standard Biological Parts</a>. In some case different enzymatic digestions were used for the appropriate vector, i.e BamHI and NcoI for the pET28 IPTG inducible expression vector. Ligated plasmids were sent out to GeneWiz for sequence confirmation.</p><br />
<br />
<h3>Transformations</h3><br />
<br />
<p>Transformations were performed using either NEB Turbo Competent E. coli cells and following the high efficiency transformation protocol recommended by the manufacturer or using fresh cultures of JM109 E. coli cells that had been made competent using the Fermentas TransformAid bacterial transformation kit and following the manufacturer’s recommended protocol.</p><br />
<br />
<h3>Quantum Dot Production in E. coli (Modified from Mi, et. al.)</h3><br />
<ol><br />
<li>Inoculate single colonies transformed with pET28-CDS7 into 1m of LB-Kanamycin media and incubate for 8 hours in a shaking incubator, set at 250 rpm, at 37 degrees Celcius until an O.D. 600 of ~1.0 was reached.</li><br />
<br />
<li>From the culture, re-inoculate 5 ml of LB-Kanamycin media to a starting optical density of 0.1 at 600 nm. </li><br />
<br />
<li>Incubate until mid-log phase is reached, O.D. 600 ~0.5, ~2 hours.</li><br />
<br />
<li>Add IPTG (formula weight.=238.3; add 0.0024 gms. per 20mls LB-Kan) to a final concentration of 0.5mM and cadmium chloride (formula weight.= 183.3; add 0.0037 gms per 20mls LB-Kan ) to a final concentration of 1mM. </li><br />
<br />
<li>Incubate in the shaker for an additional 3 hours.</li><br />
<br />
<li>Slowly add a freshly prepared solution of sodium sulfide (anhydrous formula weight.=78, nonahydrate formula weight.=240.2; we made a 100mM stock solution, 0.024 gms per ml for nonahydrate) into LB-Kan to a final concentration of 1mM.</li><br />
<br />
<li>Incubate at room temperature with slow “end-over-end” rotation for 1.5 hours.</li><br />
<br />
<li>Centrifuge and wash samples 3 times with distilled water and characterize with fluorescence spectrometry. (350nm excitation, 450nm emission for 1mM reagents, 510nm emission for 10mM reagents)</li><br />
</ol><br />
<h2>Blue light stimulated antibiotic resistance device</h2><br />
<br />
<p>Our new device consists of a blue light inducible promoter (part BBa_K28013) that had been previously characterized, driving the expression of a previously submitted chloramphenicol resistance gene (part BBa_P1004). When blue light is present, the device activates chloramphenicol resistance. This device was intended as a system for using antibiotic selection to generate quantum dots within a narrow range of wavelengths. Our submitted part uses the psB1A3 backbone as opposed to the psB1C3 backbone, since the device produces chloramphenicol resistance in the cells.</p><br />
<br />
<p>The blue light promoter is inhibited by native repressor ycgF. Without dimerizing with ycgE, ycgF will remain bound to the DNA and prevent transcription. When blue light is present, ycgF changes conformation and dimerizes with ycgE. Dimerized ycgF releases from the promoter region and no longer represses gene transcription of the chloramphenicol resistance gene. </p><br />
<br />
<p>The incubation protocol is as follows:</p><br />
<ol><br />
<li>Transformed E. coli samples containing the Blue light stimulated antibiotic resistance device and controls were incubated at 37 degrees Celsius, in a shaking incubator, irradiated in blue light. </li><br />
<li>The light induced samples were incubated in a foil lined container with 73 blue LEDs that were positioned approximately 2 cm above the sample tubes containing 1mL bacteria, 3.5ml LB broth and 5uL ampicilin.</li><br />
<li>The OD 600 reading was recorded for each sample at every hour. The dilution was 40uL sample and 160uL sterile wate. 40uL Lb broth and 160uL water was used to zero the spectrophotometer.</li><br />
<li>After the first hour of growth 5uL of chlorophenicol was added to each<br />
sample. Another 5uL was added to each sample after the 3 hour mark to<br />
ensure that there was a sufficiently high concentration of chlorophenicol within all samples.</li><br />
</ol><br />
<br />
<h2>References</h2><br />
<br />
<p>Biosynthesis and characterization of CdS quantum dots in genetically engineered<br />
Escherichia coli. Congcong Mi, Yanyan Wang, Jingpu Zhang, Huaiqing Huang, Linru Xu, Shuo <br />
Wang, Xuexun Fang, Jin Fang, Chuanbin Mao, Shukun Xu. Journal of Biotechnology. 153 (2011) 125-132.</p><br />
<br />
<p>Viral assembly of oriented quantum dot nanowires. Chuanbin Mao, Christine E. Flynn, Andrew Hayhurst, Rozamond Sweeney, Jifa Qi, George Georgiou,<br />
Brent Iverson, and Angela M. Belcher. PNAS. 100:12 (2003) 6946-6951.</p><br />
</div><br />
</body><br />
</html></div>Sunghttp://2011.igem.org/Team:Columbia-Cooper/Human_PracticesTeam:Columbia-Cooper/Human Practices2011-09-28T05:52:14Z<p>Sung: </p>
<hr />
<div>{{:Team:Columbia-Cooper/Templates/main}}<br />
<html><br />
<head><br />
<style><br />
a.hp<br />
{<br />
background-image:url("https://static.igem.org/mediawiki/2011/7/78/HPcolor.png");<br />
}<br />
</style><br />
</head><br />
<body><br />
<h1>Human Practices</h1><br />
<div style="text-align:left"><br />
<p>The Columbia-Cooper team were a lively part the Maker Faire at the New York Hall of Science this year. The World Maker Faire is the premier event for grassroots American innovation. As the World's Largest DIY Festival, this two-day family friendly Faire has something for everyone - a showcase of invention, creativity and resourcefulness and a celebration of the Maker mindset.</p><br />
<br />
<p>Genspace provided the venue at this unique event for a collaborative effort between the Columbia-Cooper and the NYC iGEM software team. The students spent the weekend of Sept.17 educating the public about synthetic biology and showing off some of their own innovations. Other team members helped to run a booth where the public were invited to extract DNA from strawberries using household items like salt, dishsoap, and coffee filters. </p><br />
<br />
<p>This was an amazing and fun experience all around. We even won the editor’s choice award for our exhibit!</p><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/8/87/ChrisSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Chris Lin meets Balvir Kunar of the NYU iGEM Software Team.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/3/3f/Chris2SM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Chris Lin shows a budding synthetic biologist some bacteria plates.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/8/8e/EveryoneSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>From right to left: Will Long, Peter Liu, Kim Kyu, and Chris Lin.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/1/1a/HannahSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Hannah Landes, a visiting iGEMer helping out at the Genspace table.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/f/f1/JustinSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Justin Fabrikant demonstrates how to use a microcentrifuge.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/4/42/MattandMinSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>WIll and Min explain iGEM and Genspace to curious visitors.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/1/1a/RikkiandSungSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Rikki Frenkel and Sung Won Lim at the Genspace table.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/e/e9/SungSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Sung shows off the Maker Fair Editor's Choice ribbon.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/1/17/TableSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>The Genspace Table at the Maker Faire.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/6/6f/PostersSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Genspace Posters at the Maker Faire.</p><br />
</div><br />
</div><br />
</body><br />
</html></div>Sunghttp://2011.igem.org/Team:Columbia-Cooper/Human_PracticesTeam:Columbia-Cooper/Human Practices2011-09-28T05:51:43Z<p>Sung: </p>
<hr />
<div>{{:Team:Columbia-Cooper/Templates/main}}<br />
<html><br />
<head><br />
<style><br />
a.hp<br />
{<br />
background-image:url("https://static.igem.org/mediawiki/2011/7/78/HPcolor.png");<br />
}<br />
</style><br />
</head><br />
<body><br />
<h1>Human Practices</h1><br />
<div style="text-align:left"><br />
<p>The Columbia-Cooper team were a lively part the Maker Faire at the New York Hall of Science this year. The World Maker Faire is the premier event for grassroots American innovation. As the World's Largest DIY Festival, this two-day family friendly Faire has something for everyone - a showcase of invention, creativity and resourcefulness and a celebration of the Maker mindset.</p><br />
<br />
<p>Genspace provided the venue at this unique event for a collaborative effort between the Columbia-Cooper and the NYC iGEM software team. The students spent the weekend of Sept.17 educating the public about synthetic biology and showing off some of their own innovations. Other team members helped to run a booth where the public were invited to extract DNA from strawberries using household items like salt, dishsoap, and coffee filters. </p><br />
<br />
<p>This was an amazing and fun experience all around. We even won the editor’s choice award for our exhibit!</p><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/8/87/ChrisSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Chris Lin meets Balvir Kunar of the NYU iGEM Software Team.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/3/3f/Chris2SM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Chris Lin shows a budding synthetic biologist some bacteria plates.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/8/8e/EveryoneSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>From right to left: Will Long, Peter Liu, Kim Kyu, and Chris Lin.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/1/1a/HannahSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Hannah Landis, a visiting iGEMer helping out at the Genspace table.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/f/f1/JustinSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Justin Fabrikant demonstrates how to use a microcentrifuge.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/4/42/MattandMinSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>WIll and Min explain iGEM and Genspace to curious visitors.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/1/1a/RikkiandSungSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Rikki Frenkel and Sung Won Lim at the Genspace table.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/e/e9/SungSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Sung shows off the Maker Fair Editor's Choice ribbon.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/1/17/TableSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>The Genspace Table at the Maker Faire.</p><br />
</div><br />
</div><br />
<div class="twrapper"><br />
<div class="pic" style="background-image:url(https://static.igem.org/mediawiki/2011/6/6f/PostersSM.jpg)"></div><br />
<div class="picinfo"><br />
<p>Genspace Posters at the Maker Faire.</p><br />
</div><br />
</div><br />
</body><br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_Software/Templates/boxesTeam:NYC Software/Templates/boxes2011-08-31T20:14:23Z<p>Sung: </p>
<hr />
<div><!-- this template is a cannabilized version of Cambridge 2010's Boxes template --><br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
#center {<br />
padding-left: 0px;<br />
margins: auto;<br />
}<br />
<br />
</style><br />
<br />
<div id='center'><br />
<div id="leftbox" style="float:left; height:200px; width:242px;" class="tophome"><br />
<div id="lefttop" style="background:#F36D21; background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png');" class="secheader">Abstract</div><br />
<div id="leftcontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px;"><br />
<p style="line-height:140%; padding-left:10px; padding-top:10px; padding-right:10px;text-align:justify; font-size:90%;"> We studied genes responsible for radiation resistance in <a style="color:#6bbe00 !important" href="https://2011.igem.org/Team:NYC_Software/Deinococcus">Deinococcus</a> and E. coli using RNA-seq technique and software analysis. In the process we were able to create a number of tools that might aid future teams in working with tools of synthetic biology and the parts registry.<br />
</div><br />
</div><br />
<br />
<br />
<div id="cbox" style="float:left; height:200px; width:241px; margin-left:5px;" class="tophome"><br />
<div id="ctop" style="background:#2353a1;background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png')" class="secheader">Team Philosophy</div><br />
<div id="ccontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px;"><br />
<p style="line-height:140%; padding-left:10px; padding-top:10px; padding-right:10px;text-align:justify; font-size:90%;">We believe the only way for the new field like synthetic biology to take root and grow to its full potentials is to foster open exchange of data and ideas. We aim to contribute to the field by developing tools that allows people to do synthetic biology easier and lets them communicate their data to and from others using uniform standard.<br />
</div><br />
</div><br />
<br />
<br />
<br />
<div id="rightbox" style="float:left; height:200px; margin-left:5px; width:242px;" class="tophome"><br />
<div id="rtop" style="background:#f3a721;background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png')" class="secheader">Tools</div><br />
<div id="rcontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px; margin-top:5px; position:relative;"><br />
<div style="position:relative; top:10px;"><br />
<a href="http://www.nysynbio.org/cgi/Parts_Explorer.html" id="leftbox" style="background:url('IMAGE URL HERE'); position:absolute; width:120px; height:100px; left:0;top:0; background-repeat:no-repeat; display:block;text-align:center; padding-top:70px; background-position: center top; color:#e53500 !important;" ><br />
Registry<br />Parts Explorer<br />
</a><br />
<a href="http://www.nysynbio.org/cgi/Biobrick_primers.cgi" id="rightbox" style="background:url('IMAGE URL HERE'); position:absolute; width:120px; height:100px; left:120px; text-align:center;top:0; background-repeat:no-repeat;display:block; padding-top:70px; background-position: center top; color:#e53500 !important;" /><br />
New Part<br />Wizard<br />
</a><br />
</div><br />
</div><br />
</div><br />
</div><br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_Software/Templates/navTeam:NYC Software/Templates/nav2011-08-26T22:56:00Z<p>Sung: </p>
<hr />
<div><html lang="en"> <br />
<head> <br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-65298-13']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<style><br />
h2{color:#96d446; }<br />
h1, h2, h3, h4, h5{font-family:"Palatino", serif; font-size:200%; line-height:35px; border-bottom:0; margin-bottom:5px; border-top:1px dotted #e3e3e3; margin-top:10px; padding-top:30px; font-weight:normal;}<br />
h2.noline{ border-top:0; margin-top:0; padding-top:0; margin-bottom:0; line-height:20px; padding-top:2px; font-size:20px;}<br />
h2.topheader{border-top:0; padding-top:0; margin-top:5px;}<br />
<br />
</style><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8.2/jquery-ui.js"></script><br />
<script type='text/javascript' src='http://www.srcf.ucam.org/~wac26/iGEM/jquery.lavalamp-1.3.4b.js'></script><br />
<script type='text/javascript' src='http://www.srcf.ucam.org/~wac26/iGEM/jquery.easing.1.3.js'></script><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Nobile:regular,bold' rel='stylesheet' type='text/css'><br />
<br />
<script type="text/javascript"> <br />
$('.left-menu ul')[0].innerHTML="<li><a href=\"https://2011.igem.org\" style=\"font-weight:bold; text-transform:none\">iGEM HQ</a></li>"+$('.left-menu ul')[0].innerHTML;<br />
$(function() {<br />
$('ul.llmenu').lavaLamp({ speed: 300, autoReturn: true , target:'li'});<br />
});<br />
$(function(){<br />
$('ul#accmenu').accordion({<br />
header:'.head',<br />
fillSpace:false,<br />
autoHeight:false,<br />
navigation:true,<br />
animated: 'easeslide'})<br />
});<br />
</script><br />
<script type="text/javascript" src="http://www.nysynbio.org/nycwiki/lightbox.js?action=raw"></script><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Vollkorn:regular,bold&subset=latin' rel='stylesheet' type='text/css'><br />
<style><br />
/**<br />
* jQuery lightBox plugin<br />
* This jQuery plugin was inspired and based on Lightbox 2 by Lokesh Dhakar (http://www.huddletogether.com/projects/lightbox2/)<br />
* and adapted to me for use like a plugin from jQuery.<br />
* @name jquery-lightbox-0.5.css<br />
* @author Leandro Vieira Pinho - http://leandrovieira.com<br />
* @version 0.5<br />
* @date April 11, 2008<br />
* @category jQuery plugin<br />
* @copyright (c) 2008 Leandro Vieira Pinho (leandrovieira.com)<br />
* @license CCAttribution-ShareAlike 2.5 Brazil - http://creativecommons.org/licenses/by-sa/2.5/br/deed.en_US<br />
* @example Visit http://leandrovieira.com/projects/jquery/lightbox/ for more informations about this jQuery plugin<br />
*/<br />
#jquery-overlay {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
z-index: 90;<br />
width: 100%;<br />
height: 500px;<br />
}<br />
#jquery-lightbox {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
width: 100%;<br />
z-index: 100;<br />
text-align: center;<br />
line-height: 0;<br />
}<br />
#jquery-lightbox a img { border: none; }<br />
#lightbox-container-image-box {<br />
position: relative;<br />
background-color: #fff;<br />
width: 250px;<br />
height: 250px;<br />
margin: 0 auto;<br />
}<br />
#lightbox-container-image { padding: 10px; }<br />
#lightbox-loading {<br />
position: absolute;<br />
top: 40%;<br />
left: 0%;<br />
height: 25%;<br />
width: 100%;<br />
text-align: center;<br />
line-height: 0;<br />
}<br />
#lightbox-nav {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
height: 100%;<br />
width: 100%;<br />
z-index: 10;<br />
}<br />
#lightbox-container-image-box > #lightbox-nav { left: 0; }<br />
#lightbox-nav a { outline: none;}<br />
#lightbox-nav-btnPrev, #lightbox-nav-btnNext {<br />
width: 49%;<br />
height: 100%;<br />
zoom: 1;<br />
display: block;<br />
}<br />
#lightbox-nav-btnPrev { <br />
left: 0; <br />
float: left;<br />
}<br />
#lightbox-nav-btnNext { <br />
right: 0; <br />
float: right;<br />
}<br />
#lightbox-container-image-data-box {<br />
font: 10px Verdana, Helvetica, sans-serif;<br />
background-color: #fff;<br />
margin: 0 auto;<br />
line-height: 1.4em;<br />
overflow: auto;<br />
width: 100%;<br />
padding: 0 10px 0;<br />
}<br />
#lightbox-container-image-data {<br />
padding: 0 10px; <br />
color: #666; <br />
}<br />
#lightbox-container-image-data #lightbox-image-details { <br />
width: 70%; <br />
float: left; <br />
text-align: left; <br />
} <br />
#lightbox-image-details-caption { font-weight: bold; }<br />
#lightbox-image-details-currentNumber {<br />
display: block; <br />
clear: left; <br />
padding-bottom: 1.0em; <br />
} <br />
#lightbox-secNav-btnClose {<br />
width: 66px; <br />
float: right;<br />
padding-bottom: 0.7em; <br />
}<br />
<br />
</style> <br />
<script><br />
$(document).ready(function() {<br />
$('a.lightbox').lightBox(); // Select all links with lightbox class<br />
$('a.image').each(function(idx, item) { <br />
var src = item.firstChild.src;<br />
src=src.replace(/wiki\/images\/thumb\/(.+)\/(.+)\/(.+)\/(.+)\..../,"wiki/images/$1/$2/$3");<br />
item.href=src;<br />
});<br />
$('a.image').lightBox();<br />
});<br />
</script><br />
<br />
<script type="text/javascript"><br />
<!--<br />
var image1=new Image()<br />
image1.src="https://static.igem.org/mediawiki/2011/8/88/Colleges.png"<br />
var image2=new Image()<br />
image2.src="https://static.igem.org/mediawiki/2011/9/99/Horizontal_cultures.png"<br />
var image3=new Image()<br />
image3.src="https://static.igem.org/mediawiki/2011/c/c1/Brooklyn_and_manhattan.jpg"<br />
//--><br />
</script><br />
<br />
<br />
<link rel="stylesheet" type="text/css" href="http://www.nysynbio.org/nycwiki/nycigem.css" /><br />
<br />
</head> <br />
<body> <br />
<style><br />
body{background-image:url('http://www.nysynbio.org/nycwiki/empire.png');<br />
background-position:top center;<br />
background-repeat: repeat-y;<br />
}<br />
<br />
</style><br />
<div id="wrap"> <br />
<div id="header"><br />
<img src="firstcar.gif" name="slide" width="965" height="200" style="padding-top: 0px"/><br />
<br />
<script><br />
<!--<br />
//variable that will increment through the images<br />
var step=1<br />
function slideit(){<br />
//if browser does not support the image object, exit.<br />
if (!document.images)<br />
return<br />
document.images.slide.src=eval("image"+step+".src")<br />
if (step<3)<br />
step++<br />
else<br />
step=1<br />
//call function "slideit()" every 5 seconds<br />
setTimeout("slideit()",5000)<br />
}<br />
slideit()<br />
//--><br />
</script><br />
<br />
</div> <br />
<map name="headermap"><br />
<area shape="rect" coords="10,30,250,240" href="https://2011.igem.org/Team:NYC_Software" /><br />
<area shape="rect" coords="888,177,942,201" href="http://www.flickr.com/people/roberts87/" /><br />
</map><br />
<div id="left"> <br />
<br />
<ul id="accmenu"><br />
<li><a class="head" href="#"> Introduction</a><br />
<ul class="llmenu llmenublue"><br />
<li><a href="/Team:NYC_Software">Home</a></li><br />
<br />
<br />
<li><a href="/Team:NYC_Software/TheTeam">Meet the Team</a></li><br />
<br />
<li><a href="/Team:NYC_Software/Photos">Photo Gallery</a></li><br />
<li><a href="/Team:NYC_Software/Videos">Videos</a></li><br />
<li><a href="/Team:NYC_Software/Space">Our Space</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a class="head" href="#">Deinococcus</a><br />
<ul class="llmenu llmenugreen"><br />
<li><a href="/Team:NYC_Software/Deinococcus/Deinococcus_Genera">The Deino Genera</a></li><br />
<li><a href="/Team:NYC_Software/Deinococcus/Previous_Studies">Previous Studies</a></li><br />
<li><a href="/Team:NYC_Software/Deinococcus/Previous_DNA_Sequencing">Genome Sequencing</a></li><br />
<li><a href="/Team:NYC_Software/Deinococcus/RNA_Sequencing">Transcriptome Sequencing</a></li><br />
<li><a href="/Team:NYC_Software/Deinococcus/Seq_Data">Data Characterisation</a></li><br />
</ul><br />
</li><br />
<br />
<!-- leftovers from Cambridge's code<br />
<li><a class="head" href="#">Project Vibrio</a><br />
<ul class="llmenu llmenublue"><br />
<li><a href="/Team:NYC_Software/Bioluminescence/Bacterial_Luciferases">Introduction</a></li><br />
<li><a href="/Team:NYC_Software/Bioluminescence/Background">Background</a></li><br />
<li><a href="/Team:NYC_Software/Bioluminescence/G28">The LuxBrick</a></li><br />
<li><a href="/Team:NYC_Software/Bioluminescence/Bacterial_Codon_optimisation">Codon optimisation</a></li><br />
<li><a href="/Team:NYC_Software/Bioluminescence/Vibrio_Modelling">Modelling</a></li><br />
<li><a href="/Team:NYC_Software/Bioluminescence/Vibrio_Characterisation">Characterisation</a></li><br />
</ul><br />
</li><br />
--><br />
<br />
<li><a class="head" href="#">Tools</a><br />
<ul class="llmenu llmenured"><br />
<li><a href="/Team:NYC_Software/Tools/Primer_Designer">Primer Design</a></li><br />
<li><a href="/Team:NYC_Software/Tools/GenBank">Registry Portal</a></li><br />
<li><a href="/Team:NYC_Software/Tools/Ligate">New Part Wizard</a></li><br />
<br />
</ul><br />
</li><br />
<br />
<!-- another Cambridge leftover<br />
<li><a class="head" href="#">Gibson Assembly</a><br />
<ul class="llmenu llmenublue"><br />
<li><a href="/Team:NYC_Software/Gibson/Introduction">Introduction</a></li><br />
<li><a href="/Team:NYC_Software/Gibson/Mechanism">How it works</a></li><br />
<li><a href="/Team:NYC_Software/Gibson/Protocol">Protocol</a></li><br />
<li><a href="/Team:NYC_Software/Gibson/RFC">RFC</a></li><br />
</ul><br />
</li><br />
--><br />
<br />
<li><a class="head" href="#">Team Philosophy</a><br />
<ul class="llmenu llmenublue"><br />
<li><a href="/Team:NYC_Software/Human_Practices">Human Practices</a></li><br />
<li><a href="/Team:NYC_Software/Safety">Safety</a></li><br />
</ul><br />
</li><br />
<br />
<li><a class="head" href="#">Future applications</a><br />
<ul class="llmenu llmenured"><br />
<li><a href="/Team:NYC_Software/Tools/Bioremediation">Bioremediation</a></li><br />
<li><a href="/Team:NYC_Software/Tools/Colonization">Colonization of Mars</a></li><br />
</ul><br />
</li><br />
<br />
<br />
<li><a class="head" href="/Team:NYC_Software/Notebook/Week1">Notebook</a><br />
<ul class="llmenu llmenuyellow"><br />
<li><a href="/Team:NYC_Software/Notebook/Summary">Summary</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week1">Week 1</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week2">Week 2</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week3">Week 3</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week4">Week 4</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week5">Week 5</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week6">Week 6</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week7">Week 7</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week8">Week 8</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week9">Week 9</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week10">Week 10</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week11">Week 11</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/Week12">Week 12</a></li><br />
<li><a href="/Team:NYC_Software/Notebook/FurtherWork">Beyond Week 12</a></li><br />
<br />
<li><a href="/Team:NYC_Software/Protocols">Protocols</a> </li><br />
</ul><br />
</li><br />
<br />
<br />
<br />
<br />
<br />
<li><a href="/Team:NYC_Software/Partners" class="head">Our Partners</a><br />
<ul class="llmenu llmenublue"><br />
<li><a href="/Team:NYC_Software/Partners">Sponsors</a> </li><br />
<li><a href="/Team:NYC_Software/iGEM_Teams">iGEM Teams</a> </li><br />
<li><a href="/Team:NYC_Software/Departments">University</a> </li><br />
<li><a href="/Team:NYC_Software/Publicity">Publicity</a> </li><br />
<br />
</ul> </li><br />
<br />
</ul><br />
<br />
</p><br />
</div> <br />
<div id="right"></div>Sunghttp://2011.igem.org/Team:NYC_Software/Templates/boxesTeam:NYC Software/Templates/boxes2011-08-26T22:43:19Z<p>Sung: </p>
<hr />
<div><!-- this template is a cannabilized version of Cambridge 2010's Boxes template --><br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
#center {<br />
padding-left: 0px;<br />
margins: auto;<br />
}<br />
<br />
</style><br />
<br />
<div id='center'><br />
<div id="leftbox" style="float:left; height:200px; width:242px;" class="tophome"><br />
<div id="lefttop" style="background:#F36D21; background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png');" class="secheader">Abstract</div><br />
<div id="leftcontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px;"><br />
<p style="line-height:140%; padding-left:10px; padding-top:10px; padding-right:10px;text-align:justify; font-size:90%;"> We studied genes responsible for radiation resistance in <a style="color:#6bbe00 !important" href="https://2011.igem.org/Team:NYC_Software/Deinococcus">Deinococcus</a> and E. coli using latest techniques in genome sequencing. With aid of RNA-seq technique and application of various genome alignment and analysis software suites we were able to study the genetic correlations of species' radiation responses. In the process we were able to create a number of tools that might aid future teams in working with tools of synthetic biology and the parts registry.<br />
</div><br />
</div><br />
<br />
<br />
<div id="cbox" style="float:left; height:200px; width:241px; margin-left:5px;" class="tophome"><br />
<div id="ctop" style="background:#2353a1;background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png')" class="secheader">Team Philosophy</div><br />
<div id="ccontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px;"><br />
<p style="line-height:140%; padding-left:10px; padding-top:10px; padding-right:10px;text-align:justify; font-size:90%;">Synthetic biology is an emerging area of multidisciplinary science that tries to take the best lessons of the engineering and informations technologies and integrate them into study and design of biological systems. We believe the only way for the new field to take root and grow to its full potentials is to foster open exchange of data and ideas. And we aim to contribute to the field by developing tools that allows people to do synthetic biology easier and lets them communicate their data to and from others using uniform standard.<br />
</div><br />
</div><br />
<br />
<br />
<br />
<div id="rightbox" style="float:left; height:200px; margin-left:5px; width:242px;" class="tophome"><br />
<div id="rtop" style="background:#f3a721;background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png')" class="secheader">Tools</div><br />
<div id="rcontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px; margin-top:5px; position:relative;"><br />
<div style="position:relative; top:10px;"><br />
<a href="http://www.nysynbio.org/cgi/Parts_Explorer.html" id="leftbox" style="background:url('IMAGE URL HERE'); position:absolute; width:120px; height:100px; left:0;top:0; background-repeat:no-repeat; display:block;text-align:center; padding-top:70px; background-position: center top; color:#e53500 !important;" ><br />
Registry<br />Parts Explorer<br />
</a><br />
<a href="http://www.nysynbio.org/cgi/Biobrick_primers.cgi" id="rightbox" style="background:url('IMAGE URL HERE'); position:absolute; width:120px; height:100px; left:120px; text-align:center;top:0; background-repeat:no-repeat;display:block; padding-top:70px; background-position: center top; color:#e53500 !important;" /><br />
New Part<br />Wizard<br />
</a><br />
</div><br />
</div><br />
</div><br />
</div><br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_Software/Templates/boxesTeam:NYC Software/Templates/boxes2011-08-26T22:40:43Z<p>Sung: </p>
<hr />
<div><!-- this template is a cannabilized version of Cambridge 2010's Boxes template --><br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
#center {<br />
padding-left: 0px;<br />
margins: auto;<br />
}<br />
<br />
</style><br />
<br />
<div id='center'><br />
<div id="leftbox" style="float:left; height:200px; width:242px;" class="tophome"><br />
<div id="lefttop" style="background:#F36D21; background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png');" class="secheader">Abstract</div><br />
<div id="leftcontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px;"><br />
<p style="line-height:140%; padding-left:10px; padding-top:10px; padding-right:10px;text-align:justify; font-size:90%;"> We studied genes responsible for radiation resistance in <a style="color:#6bbe00 !important" href="https://2011.igem.org/Team:NYC_Software/Deinococcus">Deinococcus</a> and E. coli using latest techniques in genome sequencing. With aid of RNA-seq technique and application of various genome alignment and analysis software suites we were able to study the genetic correlations of species' radiation responses. In the process we were able to create a number of tools that might aid future teams in working with tools of synthetic biology and the parts registry.<br />
</div><br />
</div><br />
<br />
<br />
<div id="cbox" style="float:left; height:250px; width:241px; margin-left:5px;" class="tophome"><br />
<div id="ctop" style="background:#2353a1;background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png')" class="secheader">Team Philosophy</div><br />
<div id="ccontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px;"><br />
<p style="line-height:140%; padding-left:10px; padding-top:10px; padding-right:10px;text-align:justify; font-size:90%;"><br/>Synthetic biology is an emerging area of multidisciplinary science that tries to take the best lessons of the engineering and informations technologies and integrate them into study and design of biological systems. We believe the only way for the new field to take root and grow to its full potentials is to foster open exchange of data and ideas. And we aim to contribute to the field by developing tools that allows people to do synthetic biology easier and lets them communicate their data to and from others using uniform standard.<br /><br />
<br />
<br />
<br />
<div id="rightbox" style="float:left; height:200px; margin-left:5px; width:242px;" class="tophome"><br />
<div id="rtop" style="background:#f3a721;background-image:url('https://static.igem.org/mediawiki/2010/a/ad/Cam-Gradient-Overlay.png')" class="secheader">Tools</div><br />
<div id="rcontent" style="background:-webkit-gradient(linear, left top, left bottom, from(#f2f2f2), to(#f8f8f8)); <br />
background: -moz-linear-gradient(top, #f2f2f2, #f8f8f8); color:#333333; height:150px; margin-top:5px; position:relative;"><br />
<div style="position:relative; top:10px;"><br />
<a href="http://www.nysynbio.org/cgi/Parts_Explorer.html" id="leftbox" style="background:url('IMAGE URL HERE'); position:absolute; width:120px; height:100px; left:0;top:0; background-repeat:no-repeat; display:block;text-align:center; padding-top:70px; background-position: center top; color:#e53500 !important;" ><br />
Registry<br />Parts Explorer<br />
</a><br />
<a href="http://www.nysynbio.org/cgi/Biobrick_primers.cgi" id="rightbox" style="background:url('IMAGE URL HERE'); position:absolute; width:120px; height:100px; left:120px; text-align:center;top:0; background-repeat:no-repeat;display:block; padding-top:70px; background-position: center top; color:#e53500 !important;" /><br />
New Part<br />Wizard<br />
</a><br />
</div><br />
</div><br />
</div><br />
</div><br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_Software/Human_PracticesTeam:NYC Software/Human Practices2011-08-26T22:33:47Z<p>Sung: </p>
<hr />
<div>{{:Team:NYC_Wetware/Templates/nav}}<br />
{{:Team:NYC_Wetware/Templates/css}}<br />
<br />
<html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM wetware</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
</head><br />
<br />
<br />
<body><br />
<br />
<br />
<div id="container"><br />
<br />
<div style="width: 700px;"><br />
<br />
<h3>World Maker Faire 2011: NYC</h3><br />
<p>The NYC iGEM software team will be volunteering at the GenspaceNYC booth in the world Maker Faire in New York City from September 17-18. For the duration of the Maker Faire we will work with the public to help them learn about synthetic biology and standard assembly method employed by iGEM teams by introducing them to various synthetically engineered organisms. We'll also introduce visitors to various software tools used in iGEM projects and walk them through design and building of a rudimentary synthetic organism in-silico, with discussions on current limits of the technology and future possibilities. </p><br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_Software/Human_PracticesTeam:NYC Software/Human Practices2011-08-26T22:32:26Z<p>Sung: </p>
<hr />
<div>{{:Team:NYC_Wetware/Templates/nav}}<br />
{{:Team:NYC_Wetware/Templates/css}}<br />
<br />
<html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM wetware</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
</head><br />
<br />
<br />
<body><br />
<br />
<br />
<div id="container"><br />
<br />
<div style="width: 700px;"><br />
<br />
<h3>World Maker Faire 2011: NYC</h3><br />
<p>The NYC iGEM software team will be volunteering at the GenspaceNYC booth in the world Maker Faire in New York City from September 17-18. For the duration of the Maker Faire we will work with the public to help them learn about synthetic biology and standard assembly method employed by iGEM teams by introducing them to various synthetically engineered organisms. We'll also introduce visitors to various software tools used in iGEM projects and walk them through design and building of a rudimentary synthetic organism in-silico, with discussions on current limits of the technology and future possibilities. </p><br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_Software/Human_PracticesTeam:NYC Software/Human Practices2011-08-26T22:31:00Z<p>Sung: </p>
<hr />
<div>{{:Team:NYC_Wetware/Templates/nav}}<br />
{{:Team:NYC_Wetware/Templates/css}}<br />
<br />
<html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM wetware</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
</head><br />
<br />
<br />
<body><br />
<br />
<br />
<div id="container"><br />
<br />
<div style="width: 700px;"><br />
<br />
<h3>World Maker Faire 2011: NYC</h3><br />
<p>The NYC iGEM software team will be volunteering at the GenspaceNYC booth in the world Maker Faire in New York City from September 17-18. For the duration of the Maker Faire we will work with the public to help them learn about synthetic biology and standard assembly method employed by iGEM teams by introducing them to various synthetically engineered organisms. We'll also introduce visitors to various software tools used in iGEM projects and walk them through design and building of a rudimentary synthetic organism in-silico, with discussions on current limits of the technology and future possibilities. </p><br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_Software/Human_PracticesTeam:NYC Software/Human Practices2011-08-26T22:27:21Z<p>Sung: </p>
<hr />
<div>{{:Team:NYC_Wetware/Templates/nav}}<br />
{{:Team:NYC_Wetware/Templates/css}}<br />
<br />
<html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM wetware</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
</head><br />
<br />
<br />
<body><br />
<br />
<br />
<div id="container"><br />
<br />
<div style="width: 700px;"><br />
<br />
<h3>World Maker Faire 2011: NYC</h3><br />
<p>The NYC iGEM software team will be volunteering at the GenspaceNYC booth in the world Maker Faire in New York City from September 17-18. For the duration of the Maker Faire we will work with the public to help them learn about synthetic biology and standard assembly method employed by iGEM teams by introducing them to various synthetically engineered organisms. We'll also introduce visitors to various software tools used in iGEM projects and walk them through design and building of a rudimentary synthetic organism in-silico, with discussions on current limits of the technology and future possibilities. </p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_SoftwareTeam:NYC Software2011-07-15T17:02:48Z<p>Sung: </p>
<hr />
<div><html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM software</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
<style type="text/css"><br />
<br />
h1 {<br />
margin: 0px;<br />
padding: 30px 20px 20px 30px;<br />
font-family: Helvetica, Arial;<br />
font-size: 50px;<br />
text-shadow: #6699a4 0px 4px 10px;<br />
color: #fff;<br />
}<br />
<br />
#container {<br />
width: 950px;<br />
margin: 10px auto 0 auto;<br />
background: #ffffff<br />
-webkit-border-radius: 20px;<br />
padding: auto;<br />
-webkit-box-shadow: #999 0px 5px 15px;<br />
}<br />
<br />
@-webkit-keyframes moveIt {<br />
0% {<br />
background-position: 0% 0%;<br />
}<br />
100% {<br />
background-position: 0% 150%;<br />
}<br />
}<br />
<br />
#header {<br />
height: 150px;<br />
background-image: url(https://static.igem.org/mediawiki/2011/e/ea/Nyc-phylotreed.png);<br />
background-position: 0% 0%;<br />
-webkit-animation-name: moveIt;<br />
-webkit-animation-duration: 20s;<br />
-webkit-animation-iteration-count: infinite;<br />
-webkit-animation-timing-function: linear;<br />
-webkit-border-radius: 20px;<br />
}<br />
<br />
#content {<br />
padding: 0px;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<br />
<body><br />
<br />
<div id="container"><br />
<br />
<div id="header"><br />
<h1>NYC-iGEM software</h1><br />
</div><br />
<br />
<div id="content"><br />
<h3>Meet the awesomeness</h3><br />
<p>Our iGEM squadron consists of students from the Dalton School, Hunter College, Columbia University, Yeshiva University, NYU-Poly, and Cornell University. Our advisers (and donated workspace) reside at Weill Cornell Medical College on the Upper East Side of Manhattan. </p><br />
<h3>What we're doing</h3><br />
<p><br />
<h4>Deinococcus Genome/ Transcriptome Sequencing</h4><br />
How can previously unresearched species inform us about radiation resistance? We are using whole genome and RNA-seq to analyze a genus' response to ionizing radiation. <br />
<h4>Registry/ Biobrick Tools</h4><br />
We also realize that there are unsolved problems on the software side of synthetic biology, so we are working with others to code tools to integrate into the Registry and are working on libraries to manipulate biobricks in general. <br />
<h3>Team Members and Affiliations</h3><br />
<p><br />
Daniel Packer - Hunter College</p><br />
<p><br />
Jakub Cichon - NYU-Poly</p><br />
<p><br />
Hannah Landes - The Dalton School</p><br />
<p><br />
Bavir Kunar - Columbia University</p><br />
<p><br />
Sung won Lim - Genspace NYC</p><br />
<br />
<h3>Weill Cornell Medical College Advisors and Grad Students</h3><br />
<p><br />
<p><br />
Russell Durrett, Christopher Mason - Institute for Computational Biology</p><br />
<p><br />
Alex Hansler, Steve Gross - Department of Pharmacology</p><br />
</div><br />
</div><br />
<br />
</body><br />
<br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_SoftwareTeam:NYC Software2011-07-15T16:53:23Z<p>Sung: </p>
<hr />
<div><html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM software</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
<style type="text/css"><br />
<br />
h1 {<br />
margin: 0px;<br />
padding: 30px 20px 20px 30px;<br />
font-family: Helvetica, Arial;<br />
font-size: 50px;<br />
text-shadow: #6699a4 0px 4px 10px;<br />
color: #fff;<br />
}<br />
<br />
#container {<br />
width: 950px;<br />
margin: 10px auto 0 auto;<br />
background: #ffffff<br />
-webkit-border-radius: 20px;<br />
padding: 0px;<br />
-webkit-box-shadow: #999 0px 5px 15px;<br />
}<br />
<br />
@-webkit-keyframes moveIt {<br />
0% {<br />
background-position: 0% 0%;<br />
}<br />
100% {<br />
background-position: 0% 150%;<br />
}<br />
}<br />
<br />
#header {<br />
height: 150px;<br />
background-image: url(https://static.igem.org/mediawiki/2011/e/ea/Nyc-phylotreed.png);<br />
background-position: 0% 0%;<br />
-webkit-animation-name: moveIt;<br />
-webkit-animation-duration: 20s;<br />
-webkit-animation-iteration-count: infinite;<br />
-webkit-animation-timing-function: linear;<br />
-webkit-border-radius: 20px;<br />
}<br />
<br />
#content {<br />
padding: 0px;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<br />
<body><br />
<br />
<div id="container"><br />
<br />
<div id="header"><br />
<h1>NYC-iGEM software</h1><br />
</div><br />
<br />
<div id="content"><br />
<h3>Meet the awesomeness</h3><br />
<p>Our iGEM squadron consists of students from the Dalton School, Hunter College, Columbia University, Yeshiva University, NYU-Poly, and Cornell University. Our advisers (and donated workspace) reside at Weill Cornell Medical College on the Upper East Side of Manhattan. </p><br />
<h3>What we're doing</h3><br />
<p><br />
<h4>Deinococcus Genome/ Transcriptome Sequencing</h4><br />
How can previously unresearched species inform us about radiation resistance? We are using whole genome and RNA-seq to analyze a genus' response to ionizing radiation. <br />
<h4>Registry/ Biobrick Tools</h4><br />
We also realize that there are unsolved problems on the software side of synthetic biology, so we are working with others to code tools to integrate into the Registry and are working on libraries to manipulate biobricks in general. <br />
<h3>Team Members and Affiliations</h3><br />
<p><br />
Daniel Packer - Hunter College</p><br />
<p><br />
Jakub Cichon - NYU-Poly</p><br />
<p><br />
Hannah Landes - The Dalton School</p><br />
<p><br />
Bavir Kunar - Columbia University</p><br />
<p><br />
Sung won Lim - Genspace NYC</p><br />
<br />
<h3>Weill Cornell Medical College Advisors and Grad Students</h3><br />
<p><br />
<p><br />
Russell Durrett, Christopher Mason - Institute for Computational Biology</p><br />
<p><br />
Alex Hansler, Steve Gross - Department of Pharmacology</p><br />
</div><br />
</div><br />
<br />
</body><br />
<br />
</html></div>Sunghttp://2011.igem.org/Team:NYC_SoftwareTeam:NYC Software2011-07-12T18:06:32Z<p>Sung: </p>
<hr />
<div><html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM software</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
<style type="text/css"><br />
<br />
h1 {<br />
margin: 0px;<br />
padding: 30px 20px 20px 30px;<br />
font-family: Helvetica, Arial;<br />
font-size: 50px;<br />
text-shadow: #6699a4 0px 4px 10px;<br />
color: #fff;<br />
}<br />
<br />
#container {<br />
width: 950px;<br />
margin: 10px auto 0 auto;<br />
background: #ffffff<br />
-webkit-border-radius: 20px;<br />
padding: 0px;<br />
-webkit-box-shadow: #999 0px 5px 15px;<br />
}<br />
<br />
@-webkit-keyframes moveIt {<br />
0% {<br />
background-position: 0% 0%;<br />
}<br />
100% {<br />
background-position: 0% 150%;<br />
}<br />
}<br />
<br />
#header {<br />
height: 150px;<br />
background-image: url(https://static.igem.org/mediawiki/2011/e/ea/Nyc-phylotreed.png);<br />
background-position: 0% 0%;<br />
-webkit-animation-name: moveIt;<br />
-webkit-animation-duration: 20s;<br />
-webkit-animation-iteration-count: infinite;<br />
-webkit-animation-timing-function: linear;<br />
-webkit-border-radius: 20px;<br />
}<br />
<br />
#content {<br />
padding: 0px;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<br />
<body><br />
<br />
<div id="container"><br />
<br />
<div id="header"><br />
<h1>NYC-iGEM software</h1><br />
</div><br />
<br />
<div id="content"><br />
<br />
</div><br />
</div><br />
<br />
</body><br />
<br />
</html></div>Sunghttp://2011.igem.org/File:Nyc-phylotreed.pngFile:Nyc-phylotreed.png2011-07-12T18:05:18Z<p>Sung: </p>
<hr />
<div></div>Sunghttp://2011.igem.org/Team:NYC_SoftwareTeam:NYC Software2011-07-12T18:02:22Z<p>Sung: </p>
<hr />
<div><html><br />
<html lang="en"><br />
<head><br />
<meta charset="utf-8"><br />
<title>NYC-iGEM software</title><br />
<meta name "description" content="nyc-igem" /><br />
<meta name="keywords" content="css3, igem" /><br />
<br />
<style type="text/css"><br />
<br />
h1 {<br />
margin: 0px;<br />
padding: 30px 20px 20px 30px;<br />
font-family: Helvetica, Arial;<br />
font-size: 50px;<br />
text-shadow: #6699a4 0px 4px 10px;<br />
color: #fff;<br />
}<br />
<br />
#container {<br />
width: 950px;<br />
margin: 10px auto 0 auto;<br />
background: #ffffff<br />
-webkit-border-radius: 20px;<br />
padding: 0px;<br />
-webkit-box-shadow: #999 0px 5px 15px;<br />
}<br />
<br />
@-webkit-keyframes moveIt {<br />
0% {<br />
background-position: 0% 0%;<br />
}<br />
100% {<br />
background-position: 0% 150%;<br />
}<br />
}<br />
<br />
#header {<br />
height: 150px;<br />
background-image: url(phylotreed.png);<br />
background-position: 0% 0%;<br />
-webkit-animation-name: moveIt;<br />
-webkit-animation-duration: 20s;<br />
-webkit-animation-iteration-count: infinite;<br />
-webkit-animation-timing-function: linear;<br />
-webkit-border-radius: 20px;<br />
}<br />
<br />
#content {<br />
padding: 0px;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<br />
<body><br />
<br />
<div id="container"><br />
<br />
<div id="header"><br />
<h1>NYC-iGEM software</h1><br />
</div><br />
<br />
<div id="content"><br />
<br />
</div><br />
</div><br />
<br />
</body><br />
<br />
</html></div>Sung