http://2011.igem.org/wiki/index.php?title=Special:Contributions/Allancrossman&feed=atom&limit=50&target=Allancrossman&year=&month=2011.igem.org - User contributions [en]2024-03-29T08:56:33ZFrom 2011.igem.orgMediaWiki 1.16.0http://2011.igem.org/Team:Edinburgh/LinksTeam:Edinburgh/Links2012-01-12T20:20:36Z<p>Allancrossman: /* Genomics */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_links');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Links</p><br />
<br />
Useful information/tools, many of which we used regularly, can be found on the following pages:<br />
<br />
===Biology methods===<br />
<br />
* [http://www.openwetware.org/wiki/French_Lab Open Wetware: French Lab protocols]<br />
** [http://www.openwetware.org/wiki/Cfrench:bbprimerdesign Primer Design]<br />
* [http://jbei-exwebapp.lbl.gov/j5/j5manual/pages/1.html J5: overview of automated DNA assembly]<br />
* [http://www.nfstc.org/pdi/Subject04/pdi_s04_m01_02.htm Primer Design] (for forensics, but probably good advice for us too)<br />
<br />
===Genomics===<br />
<br />
* [http://blast.ncbi.nlm.nih.gov/Blast.cgi BLAST: Basic Local Alignment Search Tool]<br />
* [http://en.wikipedia.org/wiki/DNA_codon_table Codon Table]<br />
* [http://www.ebi.ac.uk/ EMBL]<br />
* [http://www.ncbi.nlm.nih.gov/sites/gquery Entrez]<br />
* [http://genepool.bio.ed.ac.uk/sanger/Sanger_troubleshooting_guide_v1.pdf GenePool: Sanger Sequencing Troubleshooting]<br />
* [http://tools.neb.com/NEBcutter2/index.php NEBcutter] (finds restriction sites; also finds ORFs if they start with M)<br />
* [http://www.ebi.ac.uk/Tools/psa/ Needle] (and other pairwise alignment tools)<br />
* [http://www.bioinformatics.org/sms/rev_comp.html Reverse Complement]<br />
* [http://www.cbs.dtu.dk/services/SignalP/ SignalP]<br />
* [http://www.straininfo.net/ StrainInfo]<br />
* [http://www.ebi.ac.uk/Tools/emboss/transeq/ Transeq] (nucleotide to protein conceptual translation)<br />
* [http://www.uniprot.org/ UniProt]<br />
<br />
===iGEM===<br />
<br />
* [https://igem.org/Main_Page iGEM]<br />
** [https://2011.igem.org/Main_Page iGEM 2011]<br />
** [https://2011.igem.org/Special:RecentChanges Recent Changes to the Wiki]<br />
** [https://igem.org/Previous_iGEM_Competitions Previous iGEM competitions]<br />
** [https://2011.igem.org/Judging This year's judging criteria]<br />
** [https://2011.igem.org/Calendar_of_Events Calander of Events] (i.e. deadlines)<br />
* [http://partsregistry.org/Main_Page Parts Registry]<br />
** [http://partsregistry.org/Help Help]<br />
** [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick prefix and suffix]<br />
** [http://dspace.mit.edu/bitstream/handle/1721.1/45139/BBFRFC12.txt?sequence=1 RFC 12]<br />
** [http://dspace.mit.edu/bitstream/handle/1721.1/32535/PhillipsSilverFusion.pdf?sequence=1 RFC 23]<br />
* [http://www.wired.com/wired/archive/13.01/mit.html Life Reinvented] (article on the origins of iGEM)<br />
<br />
===Software===<br />
<br />
* [http://kappalanguage.org/ The Kappa Biological Modeling Language]<br />
** [http://www.demonsoft.org/SpatialKappa/ Spatial Kappa]<br />
* [https://www.see.ed.ac.uk/auth/teaching/courses/matlab/ MATLAB intro]<br />
* [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE Plasmid Editor]<br />
* [http://www.geospiza.com/Products/finchtv.shtml FinchTV Chromatogram Viewer]<br />
<br />
===Misc===<br />
<br />
* [https://www.wiki.ed.ac.uk/display/CFrenchLabwiki/iGEM11TeamInfo The old Wiki] (do not use)<br />
* [http://www.w3schools.com/css/default.asp CSS guide]<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/LinksTeam:Edinburgh/Links2012-01-12T20:19:29Z<p>Allancrossman: /* Genomics */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_links');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Links</p><br />
<br />
Useful information/tools, many of which we used regularly, can be found on the following pages:<br />
<br />
===Biology methods===<br />
<br />
* [http://www.openwetware.org/wiki/French_Lab Open Wetware: French Lab protocols]<br />
** [http://www.openwetware.org/wiki/Cfrench:bbprimerdesign Primer Design]<br />
* [http://jbei-exwebapp.lbl.gov/j5/j5manual/pages/1.html J5: overview of automated DNA assembly]<br />
* [http://www.nfstc.org/pdi/Subject04/pdi_s04_m01_02.htm Primer Design] (for forensics, but probably good advice for us too)<br />
<br />
===Genomics===<br />
<br />
* [http://blast.ncbi.nlm.nih.gov/Blast.cgi BLAST: Basic Local Alignment Search Tool]<br />
* [http://en.wikipedia.org/wiki/DNA_codon_table Codon Table]<br />
* [http://www.ebi.ac.uk/ EMBL]<br />
* [http://www.ncbi.nlm.nih.gov/sites/gquery Entrez]<br />
* [http://tools.neb.com/NEBcutter2/index.php NEBcutter] (finds restriction sites; also finds ORFs if they start with M)<br />
* [http://www.ebi.ac.uk/Tools/psa/ Needle] (and other pairwise alignment tools)<br />
* [http://www.bioinformatics.org/sms/rev_comp.html Reverse Complement]<br />
* [http://genepool.bio.ed.ac.uk/sanger/Sanger_troubleshooting_guide_v1.pdf GenePool: Sanger Sequencing Troubleshooting]<br />
* [http://www.cbs.dtu.dk/services/SignalP/ SignalP]<br />
* [http://www.straininfo.net/ StrainInfo]<br />
* [http://www.ebi.ac.uk/Tools/emboss/transeq/ Transeq] (nucleotide to protein conceptual translation)<br />
* [http://www.uniprot.org/ UniProt]<br />
<br />
===iGEM===<br />
<br />
* [https://igem.org/Main_Page iGEM]<br />
** [https://2011.igem.org/Main_Page iGEM 2011]<br />
** [https://2011.igem.org/Special:RecentChanges Recent Changes to the Wiki]<br />
** [https://igem.org/Previous_iGEM_Competitions Previous iGEM competitions]<br />
** [https://2011.igem.org/Judging This year's judging criteria]<br />
** [https://2011.igem.org/Calendar_of_Events Calander of Events] (i.e. deadlines)<br />
* [http://partsregistry.org/Main_Page Parts Registry]<br />
** [http://partsregistry.org/Help Help]<br />
** [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix BioBrick prefix and suffix]<br />
** [http://dspace.mit.edu/bitstream/handle/1721.1/45139/BBFRFC12.txt?sequence=1 RFC 12]<br />
** [http://dspace.mit.edu/bitstream/handle/1721.1/32535/PhillipsSilverFusion.pdf?sequence=1 RFC 23]<br />
* [http://www.wired.com/wired/archive/13.01/mit.html Life Reinvented] (article on the origins of iGEM)<br />
<br />
===Software===<br />
<br />
* [http://kappalanguage.org/ The Kappa Biological Modeling Language]<br />
** [http://www.demonsoft.org/SpatialKappa/ Spatial Kappa]<br />
* [https://www.see.ed.ac.uk/auth/teaching/courses/matlab/ MATLAB intro]<br />
* [http://biologylabs.utah.edu/jorgensen/wayned/ape/ ApE Plasmid Editor]<br />
* [http://www.geospiza.com/Products/finchtv.shtml FinchTV Chromatogram Viewer]<br />
<br />
===Misc===<br />
<br />
* [https://www.wiki.ed.ac.uk/display/CFrenchLabwiki/iGEM11TeamInfo The old Wiki] (do not use)<br />
* [http://www.w3schools.com/css/default.asp CSS guide]<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Wiki_WatchTeam:Edinburgh/Wiki Watch2011-11-16T13:57:32Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices', 'practices_wiki_watch');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Wiki Watch</p><br />
<br />
<center>''I carried out my orders until arrested. I had no sense that I was''<br />
<br>''spying, and I ask that this be taken into account in deciding my verdict.''</center><br />
<p style="text-align: center; margin-left: 14em;">&mdash; Witold Pilecki</p><br />
<br />
In order to help collaboration between teams, as well as for our own enlightenment, we put together the following list of projects. This page is now linked from the [[Community]] page, and we hope others have found it useful.<br />
<br />
Descriptions here might be incorrect for teams that switched project in the first few weeks. As of September 9, [[Jamboree/Team Abstracts | full team abstracts are available]].<br />
<br />
High School teams are not shown (unless participating in the main event). Teams that withdrew without making substantive wiki edits have been hidden. Teams that [https://igem.org/Results?year=2011 advanced] to the finals in MIT are highlighted.<br />
<br />
{| style="font-size: 9pt"<br />
|-<br />
| <span style="font-size: 150%;">'''Americas'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| [[Team:Alberta | Alberta]]<br />
| Converting biomass to biodiesel using ''[http://en.wikipedia.org/wiki/Neurospora_crassa Neurospora crassa]''.<br />
|-<br />
| [[Team:Arizona State | Arizona State]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
|-<br />
| [[Team:Baltimore | Baltimore]]<br />
| Creation of a [http://en.wikipedia.org/wiki/Taq_polymerase Taq polymerase] BioBrick.<br />
|-<br />
| [[Team:Bard-Annandale | Bard-Annandale]]<br />
| Logical construct involving quorum sensing and Lux genes.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Berkeley | Berkeley]]<br />
| style="background-color: #eeffee;" | Stress-repressed promoter in front of stress-producing (toxic) product to regulate its level.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:British Columbia | British Columbia]]<br />
| style="background-color: #eeffee;" | Production of [http://en.wikipedia.org/wiki/Monoterpene monoterpenes] in yeast, to investigate their anti-fungal properties.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Brown-Stanford | Brown-Stanford]]<br />
| style="background-color: #eeffee;" | Mars! ''[http://en.wikipedia.org/wiki/Sporosarcina_pasteurii S. pasteurii]'' to make calcium carbonate; biosensor; cyanobacteria/''E. coli'' symbiosis.<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:BU Wellesley Software | BU Wellesley Software]]<br />
| style="background-color: #ffffee;" | (Software) Involves plasmid design, recombinases, and tuberculosis?<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:BYU Provo | BYU Provo]]<br />
| style="background-color: #eeffee;" | AND gate: OxyR (input: H2O2) + [http://en.wikipedia.org/wiki/Riboswitch riboswitch] (input: high temperature). Output via [http://en.wikipedia.org/wiki/Cre-Lox_recombination Cre-Lox].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Calgary | Calgary]]<br />
| style="background-color: #eeffee;" | Biosensor for [http://en.wikipedia.org/wiki/Naphthenic_acid naphthenic acids].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Caltech | Caltech]]<br />
| style="background-color: #eeffee;" | Bioremediation of organic pollutants, especially [http://en.wikipedia.org/wiki/Endocrine_disruptor endocrine disruptors].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Colombia | Colombia]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that recognise fungal pathogens by their [http://en.wikipedia.org/wiki/Chitin chitin], and destroy it or induce plant defenses.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Columbia-Cooper | Columbia-Cooper]]<br />
| style="background-color: #eeffee;" | Using metal-binding peptides to form [http://en.wikipedia.org/wiki/Quantum_dot quantum dots].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Cornell | Cornell]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that will lyse themselves upon receiving some specific light wavelength.<br />
|-<br />
| [[Team:Duke | Duke]]<br />
| Something to do with "increasing the robustness of bacterial gene networks".<br />
|-<br />
| [[Team:Gaston Day School | Gaston Day School]]<br />
| Nitrate detector with output as Red Fluorescent Protein.<br />
|-<br />
| [[Team:GeorgiaState | GeorgiaState]]<br />
| BioBricks from ''[http://en.wikipedia.org/wiki/Pichia_pastoris Pichia pastoris]'' promoters. Characterise with GFP.<br />
|-<br />
| [[Team:GeorgiaTech | GeorgiaTech]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
<!--<br />
|-<br />
| [[Team:Greenfield IN-Rihm-HS | Greenfield IN-Rihm-HS]]<br />
| Cadmium biosensor in ''S. cerevisiae'' (i.e. Brewer's Yeast)<br />
|-<br />
| [[Team:Greenfield IN-Schini-HS | Greenfield IN-Schini-HS]]<br />
| Arsenic biosensor in ''S. cerevisiae''.<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Grinnell | Grinnell]]<br />
| style="background-color: #eeffee;" | Secretion of [http://en.wikipedia.org/wiki/biofilm biofilm]-degrading compounds from ''[http://en.wikipedia.org/wiki/Caulobacter_crescentus Caulobacter crescentus]''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Harvard | Harvard]]<br />
| style="background-color: #eeffee;" | Improved targetting of gene therapy using [http://en.wikipedia.org/wiki/Zinc_finger zinc finger] DNA binding proteins.<br />
|-<br />
| [[Team:Hunter-NYC | Hunter-NYC]]<br />
| Removal of metal ions from contaminated water, using lipase secretion tag.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ITESM Mexico | ITESM Mexico]]<br />
| style="background-color: #eeffee;" | [http://en.wikipedia.org/wiki/Arabinose Arabinose] biosensor with (concentration dependent) output using GFP or CFP.<br />
|-<br />
| [[Team:IvyTech-South Bend | IvyTech-South Bend]]<br />
| Arsenic biosensor with output via smell. May use ''E. coli'' or ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Johns Hopkins | Johns Hopkins]]<br />
| style="background-color: #eeffee;" | Production of vitamins and minerals in ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Lethbridge | Lethbridge]]<br />
| style="background-color: #eeffee;" | Bioremediation e.g. of heavy metals.<br />
|-<br />
| [[Team:McGill | McGill]]<br />
| Control of mammalian cells using light.<br />
|-<br />
| [[Team:Michigan | Michigan]]<br />
| Bind DNA-binding protein to ''E. coli'' membrane; attach to surfaces that have oligonucleotides.<br />
|-<br />
| [[Team:Minnesota | Minnesota]]<br />
| Light-induced silicatein fused to ompA or Ice Nucleation Protein for 3D printing.<br />
|-<br />
| [[Team:Missouri Miners | Missouri Miners]]<br />
| Alteration of [http://ecoliwiki.net/colipedia/index.php/ompR ompR] system to activate at different glucose concentrations.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:MIT | MIT]]<br />
| style="background-color: #eeffee;" | Mammalian [http://en.wikipedia.org/wiki/Juxtacrine_signalling juxtacrine signalling] and [http://en.wikipedia.org/wiki/G_protein-coupled_receptor G protein-coupled receptors].<br />
|-<br />
| [[Team:Nevada | Nevada]]<br />
| Sugar production from cyanobacteria, to feed ''E. coli'' that make biofuel.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Northwestern | Northwestern]]<br />
| style="background-color: #eeffee;" | Detection of ''[http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa Pseudomonas aeruginosa]'' by using its quorum sensing system.<br />
|-<br />
| [[Team:NYC Software | NYC Software]]<br />
| (Software) Genome analysis focusing on radiation tolerance.<br />
|-<br />
| [[Team:NYC Wetware | NYC Wetware]]<br />
| Making ''E. coli'' radiotolerant by using genes from ''[http://en.wikipedia.org/wiki/Deinococcus_radiodurans Deinococcus radiodurans]''.<br />
|-<br />
| [[Team:Panama | Panama]]<br />
| Synthesis of rhamnolipids.<br />
|-<br />
| [[Team:Penn | Penn]]<br />
| Cell-cell communication via light.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Penn State | Penn State]]<br />
| style="background-color: #eeffee;" | Radiation detector using Phage Lambda lytic switch system.<br />
|-<br />
| [[Team:Purdue | Purdue]]<br />
| Bistable toggle switch using [http://en.wikipedia.org/wiki/Phytochrome phytochromes].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Queens Canada | Queens Canada]]<br />
| style="background-color: #eeffee;" | Using [http://en.wikipedia.org/wiki/C._elegans the worm] for sensing pollutants by swimming to them.<br />
|-<br />
| [[Team:Rutgers | Rutgers]]<br />
| Bacteria responding to lasers; addition of numbers in bacteria; BioBrick validation.<br />
<!--<br />
|-<br />
| [[Team:SouthBend-Mishawaka-HS | SouthBend-Mishawaka-HS]]<br />
| Detect ''[http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa Pseudomonas aeruginosa]'' and report by lux.<br />
|-<br />
| [[Team:SouthBend-Mishawaka-HS-2]]<br />
| Arsenic biosensor; report with GFP or an odour.<br />
--><br />
|-<br />
| [[Team:Tec-Monterrey | Tec-Monterrey]]<br />
| Production of high fructose syrup using membrane-bound fusion proteins.<br />
|-<br />
| [[Team:Toronto | Toronto]]<br />
| Incorporating a magnetosome system into ''E. coli?''<br />
<!--<br />
|-<br />
| [[Team:TorontoMaRSDiscovery | TorontoMaRSDiscovery]]<br />
|<br />
--><br />
|-<br />
| [[Team:UANL Mty-Mexico | UANL Mty-Mexico]]<br />
| Logic gates taking light signals as inputs.<br />
|-<br />
| [[Team:UCSF | UCSF]]<br />
| Production of biofilms with ''S. cerevisiae'', by cell display of adhesive proteins.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UC Davis | UC Davis]]<br />
| style="background-color: #eeffee;" | Mutagenesis on promoters and repressors to produce new behaviours.<br />
|-<br />
| [[Team:UIUC-Illinois | UIUC-Illinois]]<br />
| Different plasmids in a cell; choose which is active by making one go to high copy number.<br />
|-<br />
| [[Team:UNAM-Genomics Mexico | UNAM-Genomics Mexico]]<br />
| Hydrogen production in ''[http://en.wikipedia.org/wiki/Rhizobium_etli Rhizobium etli]'' in ''[http://en.wikipedia.org/wiki/Phaseolus_vulgaris Phaseolus vulgaris]''.<br />
|-<br />
| [[Team:UNAM-ITESM Mexico City | UNAM-ITESM Mexico City]]<br />
| Rubber-degrading bacteria.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UNICAMP-EMSE Brazil | UNICAMP-EMSE Brazil]]<br />
| style="background-color: #eeffee;" | Detect mammal's stress by [http://en.wikipedia.org/wiki/Catecholamine catecholamines] and [http://en.wikipedia.org/wiki/Nitric_oxide nitric oxide]; regulate it with [http://en.wikipedia.org/wiki/Cytokine cytokines].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:uOttawa | uOttawa]]<br />
| style="background-color: #eeffee;" | Improving ''S. cerevisiae'' for use with BioBricks.<br />
|-<br />
| [[Team:USC | USC]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
|-<br />
| [[Team:Utah State | Utah State]]<br />
| Production of valuable compounds using the cyanobacterium ''[http://en.wikipedia.org/wiki/Synechocystis Synechocystis]''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UTP-Panama | UTP-Panama]]<br />
| style="background-color: #eeffee;" | Various.<br />
|-<br />
| [[Team:UT Dallas | UT Dallas]]<br />
| Repair of human tissue using bacteria.<br />
|-<br />
| [[Team:VCU | VCU]]<br />
| Various projects involving the cyanobacterium ''[http://en.wikipedia.org/wiki/Synechococcus Synechococcus elongatus]''.<br />
|-<br />
| [[Team:Virginia | Virginia]]<br />
| Using ''S. cerevisiae'' to produce factors which heal human wounds.<br />
|-<br />
| [[Team:Virginia Tech | Virginia Tech]]<br />
| Fluorescent proteins that fold and degrade quickly, to be used as reporters.<br />
<!--<br />
|-<br />
| [[Team:WarrenCIndpls IN-HS | WarrenCIndpls IN-HS]]<br />
| Metal biosensor in ''S. cerevisiae''.<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Washington | Washington]]<br />
| style="background-color: #eeffee;" | Alkanes in ''E. coli''; luciferase in yeast; [http://en.wikipedia.org/wiki/Gluten gluten]-cleaving enzyme; [http://en.wikipedia.org/wiki/Magnetosome magnetosomes] in ''E. coli''.<br />
|-<br />
| [[Team:WashU | WashU]]<br />
| [http://en.wikipedia.org/wiki/Carotene B-Carotene] and [http://en.wikipedia.org/wiki/Ionone B-Ionone] production in ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Waterloo | Waterloo]]<br />
| style="background-color: #eeffee;" | Creation of ribozymes that will excise out of an RNA transcript.<br />
|-<br />
| [[Team:West Point | West Point]]<br />
| Detect ''Vibrio cholerae'' by letting it lyse ''E. coli'', releasing &beta;-galactosidase.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Wisconsin-Madison | Wisconsin-Madison]]<br />
| style="background-color: #eeffee;" | Biosensors to detect biofuels?<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Yale | Yale]]<br />
| style="background-color: #eeffee;" | Production of antifreeze using ''E. coli'' and a gene from the ''Rhagium inquisitor'' beetle.<br />
|-<br />
| <span style="font-size: 150%;">'''Asia'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ArtScienceBangalore | ArtScienceBangalore]]<br />
| style="background-color: #eeffee;" | Environmental mapping / metagenomics<br />
|-<br />
| [[Team:CBNU-Korea | CBNU-Korea]]<br />
| (Software) Synthesising a minimal chromosome.<br />
<!--<br />
|-<br />
| [[Team:CTGU-Yichang | CTGU-Yichang]]<br />
|<br />
--><br />
|-<br />
| [[Team:Fudan-Shanghai | Fudan-Shanghai]]<br />
| Nitrate detection; switching between different colour production; something else.<br />
|-<br />
| [[Team:HIT-Harbin | HIT-Harbin]]<br />
| Yoghurt bacteria that stop producing acid once the yoghurt is acidic enough.<br />
|-<br />
| [[Team:HKU-Hong Kong | HKU-Hong Kong]]<br />
| Silencing specific genes with a modified histone-like nucleoid structuring protein.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:HKUST-Hong Kong | HKUST-Hong Kong]]<br />
| style="background-color: #eeffee;" | Degrading [http://en.wikipedia.org/wiki/Indole indole] using toluene-4-monooxygenase, to boost antibiotic susceptibility.<br />
|-<br />
| [[Team:HokkaidoU Japan | HokkaidoU Japan]]<br />
| Type III secretion system to inject stuff into eukaryotic cells.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Hong Kong-CUHK | Hong Kong-CUHK]]<br />
| style="background-color: #eeffee;" | Light-driven ion pump to produce electricity.<br />
<!--<br />
|-<br />
| [[Team:HSU | HSU]]<br />
|<br />
--><br />
|-<br />
| [[Team:HUST-China | HUST-China]]<br />
| (Software?) Modification of gut-colonising bacteria to degrade alcohol; prevent drunkenness.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:IIT Madras | IIT Madras]]<br />
| style="background-color: #eeffee;" | Modular biosensors.<br />
|-<br />
| [[Team:KAIST-Korea | KAIST-Korea]]<br />
| Artistic ''E. coli'', expressing fluorescence in response to quorum sensing molecules.<br />
|-<br />
| [[Team:KAIT Japan | KAIT Japan]]<br />
| Colony-colony interaction and quorum sensing inhibition.<br />
|-<br />
| [[Team:KIT-Kyoto | KIT-Kyoto]]<br />
| Using quorum sensing to turn on and off GFP expression for aesthetic purposes.<br />
|-<br />
| [[Team:Korea U Seoul | Korea U Seoul]]<br />
| Production of [http://en.wikipedia.org/wiki/Alkane alkanes] from glucose.<br />
|-<br />
| [[Team:Kyoto | Kyoto]]<br />
| Attracting insects with light, trapping them with gum, and digesting them.<br />
|-<br />
| [[Team:Macquarie Australia | Macquarie Australia]]<br />
| "Bacterial light switch" involving [http://en.wikipedia.org/wiki/Phytochrome bacteriaphytochrome] and [http://en.wikipedia.org/wiki/Heme_oxygenase heme oxygenase].<br />
<!--<br />
|-<br />
| [[Team:Nanjing | Nanjing]]<br />
|<br />
--><br />
|-<br />
| [[Team:NCTU Formosa | NCTU Formosa]]<br />
| Temperature controlled expression; testing with [http://en.wikipedia.org/wiki/Carotenoid carotenoid], violacein, and [http://en.wikipedia.org/wiki/Butanol butanol] synthesis.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:NYMU-Taipei | NYMU-Taipei]]<br />
| style="background-color: #eeffee;" | Something involving magnetosomes to transduce a signal; also DNA for information storage.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Osaka | Osaka]]<br />
| style="background-color: #eeffee;" | Radiation dosimeter using DNA repair systems to detect radiation.<br />
|-<br />
| [[Team:OUC-China | OUC-China]]<br />
| Promotion and inhibition of bacterial strains by each other.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Peking R | Peking R]]<br />
| style="background-color: #eeffee;" | Something involving [http://en.wikipedia.org/wiki/Riboswitch riboswitches] and synthetic ribosome binding sites.<br />
|-<br />
| [[Team:Peking S | Peking S]]<br />
| Something with cell-cell communication.<br />
<!--<br />
|-<br />
| [[Team:Rajasthan | Rajasthan]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:SJTU-BioX-Shanghai | SJTU-BioX-Shanghai]]<br />
| style="background-color: #eeffee;" | Translational control.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:SYSU-China | SYSU-China]]<br />
| style="background-color: #eeffee;" | Bacteria that move towards ionising radiation and absorb radioisotopes.<br />
|-<br />
| [[Team:Tianjin | Tianjin]]<br />
| Adjusting the yeast TOR (Target Of Rapamycin) protein to aid survival in [http://en.wikipedia.org/wiki/Lignocellulose lignocellulose].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tokyo-NoKoGen | Tokyo-NoKoGen]]<br />
| style="background-color: #eeffee;" | Bacteria that absorb radioactive [http://en.wikipedia.org/wiki/Caesium caesium].<br />
|-<br />
| [[Team:Tokyo Metropolitan | Tokyo Metropolitan]]<br />
| Killer ''E. coli'' that swim to some "target" and kill it.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tokyo Tech | Tokyo Tech]]<br />
| style="background-color: #eeffee;" | Rock/Paper/Scissors bacteria; urea production; [http://en.wikipedia.org/wiki/Isoprene isoprene] for cloud seeding.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tsinghua | Tsinghua]]<br />
| style="background-color: #eeffee;" | Something involving movement of proteins.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tsinghua-A | Tsinghua-A]]<br />
| style="background-color: #eeffee;" | Oscillation between red and green fluorescence, using quorum sensing.<br />
|-<br />
| [[Team:TzuChiU Formosa | TzuChiU Formosa]]<br />
| Conversion of CO to CO2 using [http://en.wikipedia.org/wiki/Carbon_monoxide_dehydrogenase carbon monoxide dehydrogenase] in ''[http://en.wikipedia.org/wiki/Rhodospirillum_rubrum Rhodospirillum rubrum]''.<br />
|-<br />
| [[Team:UNIST Korea | UNIST Korea]]<br />
| An organism which will kill itself upon escape from the lab.<br />
|-<br />
| [[Team:UQ-Australia | UQ-Australia]]<br />
| 24-hour bacterial oscillator.<br />
|-<br />
| [[Team:UST-Beijing | UST-Beijing]]<br />
| Bile acid sensor involving [http://en.wikipedia.org/wiki/Liver_X_receptor_beta LXR-&Beta;].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:USTC-China | USTC-China]]<br />
| style="background-color: #eeffee;" | "Self-organized bacteria"; project involves [http://en.wikipedia.org/wiki/Riboswitch riboswitches].<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:USTC-Software | USTC-Software]]<br />
| style="background-color: #ffffee;" | (Software) Visual tool for analysing dynamics of biological systems.<br />
|-<br />
| [[Team:UT-Tokyo | UT-Tokyo]]<br />
| Bacteria that respond to stress by creating a signal, which other bacteria swim towards.<br />
|-<br />
| [[Team:VIT Vellore | VIT Vellore]]<br />
| Enteric bacteria producing drugs or other compounds for the body.<br />
|-<br />
| [[Team:Waseda-Japan | Waseda-Japan]]<br />
| Responding to different colours of light, detected by CcaS and CcaR.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:WHU-China | WHU-China]]<br />
| style="background-color: #eeffee;" | Bacterial communication with light; also colour photography using ''E. coli''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:XMU-China | XMU-China]]<br />
| style="background-color: #eeffee;" | Control of cell density with a killer gene.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ZJU-China | ZJU-China]]<br />
| style="background-color: #eeffee;" | Using different oxygen levels in biofilms to control different expression patterns.<br />
|-<br />
| <span style="font-size: 150%;">'''Europe'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| [[Team:Amsterdam | Amsterdam]]<br />
| Make ''E. coli'' psychrophilic (cold loving).<br />
<!--<br />
|-<br />
| [[Team:BCCS-Bristol | BCCS-Bristol]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Bielefeld-Germany | Bielefeld-Germany]]<br />
| style="background-color: #eeffee;" | Cell-free biosensor for bisphenol A.<br />
|-<br />
| [[Team:Bilkent UNAM Turkey | Bilkent UNAM Turkey]]<br />
| Production of protein from algae e.g. ''[http://en.wikipedia.org/wiki/Chlamydomonas_reinhardtii Chlamydomonas reinhardtii]''.<br />
|-<br />
| [[Team:Cambridge | Cambridge]]<br />
| Bacterial expression of [http://en.wikipedia.org/wiki/Reflectin reflectins] from ''Loligo'' squid.<br />
|-<br />
| [[Team:CongoDRC-Bel Campus | CongoDRC-Bel Campus]]<br />
| Vaccine for ''[http://en.wikipedia.org/wiki/Mycobacterium_ulcerans Mycobacterium ulcerans]''.<br />
|-<br />
| [[Team:Copenhagen | Copenhagen]]<br />
| Removal of pharmaceutical products from water with [http://en.wikipedia.org/wiki/Cytochrome_P450 cytochrome P450].<br />
|-<br />
| [[Team:Debrecen Hungary | Debrecen Hungary]]<br />
| Something with Nuclear Hormone Receptors: ligand activated transcription factors.<br />
|-<br />
| [[Team:DTU-Denmark | DTU-Denmark]]<br />
| Using sRNA for post-transcriptional regulation.<br />
|-<br />
| [[Team:DTU-Denmark-2 | DTU-Denmark-2]]<br />
| A new assembly method using uracil-excision based cloning.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Dundee | Dundee]]<br />
| style="background-color: #eeffee;" | Creation of [http://en.wikipedia.org/wiki/Bacterial_microcompartment bacterial microcompartments].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Edinburgh | Edinburgh]]<br />
| style="background-color: #eeffee;" | Display of cellulases on M13 (via pVIII) or on cell surface (via Ice Nucleation Protein).<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:ENSPS-Strasbourg | ENSPS-Strasbourg]]<br />
| style="background-color: #ffffee;" | (Software) GUI for designing synthetic systems.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:EPF-Lausanne | EPF-Lausanne]]<br />
| style="background-color: #eeffee;" | Creation of new [http://en.wikipedia.org/wiki/Transcription_factor transcription factors].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ETH Zurich | ETH Zurich]]<br />
| style="background-color: #eeffee;" | Biological smoke detector by detection of [http://en.wikipedia.org/wiki/Acetaldehyde acetaldehyde].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Fatih Turkey | Fatih Turkey]]<br />
| style="background-color: #eeffee;" | Using ''[http://en.wikipedia.org/wiki/B._subtilis B. subtilis]'' to detect ''E. coli?''<br />
|-<br />
| [[Team:Freiburg | Freiburg]]<br />
| A cheaper system for protein purification.<br />
|-<br />
| [[Team:Glasgow | Glasgow]]<br />
| Light-controlled expression of bacteria inside biofilms.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Grenoble | Grenoble]]<br />
| style="background-color: #eeffee;" | Determination of metal concentration by growing reporter bacteria on an IPTG gradient.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Groningen | Groningen]]<br />
| style="background-color: #eeffee;" | Remember that an input has occurred; use a biological [http://en.wikipedia.org/wiki/AND_gate AND gate] to count occurrences.<br />
<!--<br />
|-<br />
| [[Team:HU-Micro | HU-Micro]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Imperial College London | Imperial College London]]<br />
| style="background-color: #eeffee;" | Something involving [http://en.wikipedia.org/wiki/Auxin auxin], and dealing with soil erosion.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:KULeuven | KULeuven]]<br />
| style="background-color: #eeffee;" | Creation and prevention of ice with Ice Nucleation Protein and Anti Freeze Protein.<br />
|-<br />
| [[Team:LMU-Munich | LMU-Munich]]<br />
| Metal biosensors with a focus on quantification.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Lyon-INSA-ENS | Lyon-INSA-ENS]]<br />
| style="background-color: #eeffee;" | Biofilter for radioactive waste.<br />
|-<br />
| [[Team:METU-Ankara | METU-Ankara]]<br />
| Methane biosensor and methane conversion into methanol.<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:METU-BIN Ankara | METU-BIN Ankara]]<br />
| style="background-color: #ffffee;" | (Software) Web based tool for construct planning.<br />
|-<br />
| [[Team:METU Turkey SoftLab | METU Turkey SoftLab]]<br />
| (Software) "BioGuide".<br />
|-<br />
| [[Team:Nairobi | Nairobi]]<br />
| Engineering a fungus to kill insects.<br />
|-<br />
| [[Team:NTNU Trondheim | NTNU Trondheim]]<br />
| Detection of bacterial stress; based on the ''E. coli'' "[http://en.wikipedia.org/wiki/Stringent_response stringent response]" which produces ppGpp.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Paris Bettencourt | Paris Bettencourt]]<br />
| style="background-color: #eeffee;" | Passing signals e.g. RNA from cell to cell via nanotubes.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Potsdam Bioware | Potsdam Bioware]]<br />
| style="background-color: #eeffee;" | Directed evolution of cyclic peptides for therapeutics. Use phage display, error-prone PCR.<br />
|-<br />
| [[Team:Sevilla | Sevilla]]<br />
| Biological circuits using multiple different genotypes at once.<br />
<!--<br />
|-<br />
| [[Team:Strathclyde Glasgow | Strathclyde Glasgow]]<br />
|<br />
--><br />
|-<br />
| [[Team:St Andrews | St Andrews]]<br />
| Production of anti-microbial peptides in ''E. coli'' to kill bacteria.<br />
|-<br />
| [[Team:TU-Delft | TU-Delft]]<br />
| Expressing mussel glue protein in ''E. coli'' to attach to stuff, with inducible detachment.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:TU Munich | TU Munich]]<br />
| style="background-color: #eeffee;" | 3D printing by immobilising ''E. coli'' in a gel; turn on genes iff 2 different colour lasers hit.<br />
|-<br />
| [[Team:UCL London | UCL London]]<br />
| Using [http://en.wikipedia.org/wiki/DNA_gyrase gyrase] to increase supercoiling of plasmids.<br />
|-<br />
| [[Team:UEA-JIC Norwich | UEA-JIC Norwich]]<br />
| Glow-in-the-dark bacteria, protists, and moss.<br />
|-<br />
| [[Team:ULB-Brussels | ULB-Brussels]]<br />
| Tools for inserting or deleting genes in the main ''E. coli'' chromosome. <br />
|-<br />
| [[Team:UNIPV-Pavia | UNIPV-Pavia]]<br />
| Regulating a quorum sensing molecule by negative feedback.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UNITS Trieste | UNITS Trieste]]<br />
| style="background-color: #eeffee;" | Synthetic biome where bacteria and eukaryotic cells depend on each other to survive.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UPO-Sevilla | UPO-Sevilla]]<br />
| style="background-color: #eeffee;" | Biological memory with bistable toggle switches.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Uppsala-Sweden | Uppsala-Sweden]]<br />
| style="background-color: #eeffee;" | Light-induced gene expression.<br />
<!--<br />
|-<br />
| [[Team:UTP-Poland | UTP-Poland]]<br />
|<br />
--><br />
|-<br />
| [[Team:Valencia | Valencia]]<br />
| Production of antimicrobial peptides to clean up drinking water.<br />
|-<br />
| [[Team:Wageningen UR | Wageningen UR]]<br />
| Oscillating, synchronised gene expression in ''E. coli'', and communication along fungal [http://en.wikipedia.org/wiki/Hypha hyphae].<br />
|-<br />
| [[Team:Warsaw | Warsaw]]<br />
| Cell-free cloning using [http://www.neb.com/nebecomm/products/productM0269.asp phi29 DNA polymerase]; also insertion of stuff into main genome.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:WITS-CSIR SA | WITS-CSIR SA]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that search for a ligand then, upon finding it, return to a point of origin and report.<br />
|}<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Wiki_WatchTeam:Edinburgh/Wiki Watch2011-11-16T13:55:13Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices', 'practices_wiki_watch');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Wiki Watch</p><br />
<br />
<center>''I carried out my orders until arrested. I had no sense that I was''<br />
<br>''spying, and I ask that this be taken into account in deciding my verdict.''</center><br />
<p style="text-align: center; margin-left: 14em;">&mdash; Witold Pilecki</p><br />
<br />
In order to help collaboration between teams, as well as for our own enlightenment, we put together the following list of projects. This page is now linked from the [[Community]] page, and we hope others have found it useful.<br />
<br />
Descriptions here might be incorrect for teams that switched project in the first few weeks. As of September 9, [[Jamboree/Team Abstracts | full team abstracts are available]].<br />
<br />
High School teams are not shown (unless participating in the main event). Teams that withdrew without making substantive wiki edits have been hidden. Teams that [https://igem.org/Results?year=2011 advanced] to the finals in MIT are highlighted.<br />
<br />
{| style="font-size: 9pt"<br />
|-<br />
| <span style="font-size: 150%;">'''Americas'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| [[Team:Alberta | Alberta]]<br />
| Converting biomass to biodiesel using ''[http://en.wikipedia.org/wiki/Neurospora_crassa Neurospora crassa]''.<br />
|-<br />
| [[Team:Arizona State | Arizona State]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
|-<br />
| [[Team:Baltimore | Baltimore]]<br />
| Creation of a [http://en.wikipedia.org/wiki/Taq_polymerase Taq polymerase] BioBrick.<br />
|-<br />
| [[Team:Bard-Annandale | Bard-Annandale]]<br />
| Logical construct involving quorum sensing and Lux genes.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Berkeley | Berkeley]]<br />
| style="background-color: #eeffee;" | Stress-repressed promoter in front of stress-producing (toxic) product to regulate its level.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:British Columbia | British Columbia]]<br />
| style="background-color: #eeffee;" | Production of [http://en.wikipedia.org/wiki/Monoterpene monoterpenes] in yeast, to investigate their anti-fungal properties.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Brown-Stanford | Brown-Stanford]]<br />
| style="background-color: #eeffee;" | Mars! ''[http://en.wikipedia.org/wiki/Sporosarcina_pasteurii S. pasteurii]'' to make calcium carbonate; biosensor; cyanobacteria/''E. coli'' symbiosis.<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:BU Wellesley Software | BU Wellesley Software]]<br />
| style="background-color: #ffffee;" | (Software) Involves plasmid design, recombinases, and tuberculosis?<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:BYU Provo | BYU Provo]]<br />
| style="background-color: #eeffee;" | AND gate: OxyR (input: H2O2) + [http://en.wikipedia.org/wiki/Riboswitch riboswitch] (input: high temperature). Output via [http://en.wikipedia.org/wiki/Cre-Lox_recombination Cre-Lox].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Calgary | Calgary]]<br />
| style="background-color: #eeffee;" | Biosensor for [http://en.wikipedia.org/wiki/Naphthenic_acid naphthenic acids].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Caltech | Caltech]]<br />
| style="background-color: #eeffee;" | Bioremediation of organic pollutants, especially [http://en.wikipedia.org/wiki/Endocrine_disruptor endocrine disruptors].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Colombia | Colombia]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that recognise fungal pathogens by their [http://en.wikipedia.org/wiki/Chitin chitin], and destroy it or induce plant defenses.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Columbia-Cooper | Columbia-Cooper]]<br />
| style="background-color: #eeffee;" | Using metal-binding peptides to form [http://en.wikipedia.org/wiki/Quantum_dot quantum dots].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Cornell | Cornell]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that will lyse themselves upon receiving some specific light wavelength.<br />
|-<br />
| [[Team:Duke | Duke]]<br />
| Something to do with "increasing the robustness of bacterial gene networks".<br />
|-<br />
| [[Team:Gaston Day School | Gaston Day School]]<br />
| Nitrate detector with output as Red Fluorescent Protein.<br />
|-<br />
| [[Team:GeorgiaState | GeorgiaState]]<br />
| BioBricks from ''[http://en.wikipedia.org/wiki/Pichia_pastoris Pichia pastoris]'' promoters. Characterise with GFP.<br />
|-<br />
| [[Team:GeorgiaTech | GeorgiaTech]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
<!--<br />
|-<br />
| [[Team:Greenfield IN-Rihm-HS | Greenfield IN-Rihm-HS]]<br />
| Cadmium biosensor in ''S. cerevisiae'' (i.e. Brewer's Yeast)<br />
|-<br />
| [[Team:Greenfield IN-Schini-HS | Greenfield IN-Schini-HS]]<br />
| Arsenic biosensor in ''S. cerevisiae''.<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Grinnell | Grinnell]]<br />
| style="background-color: #eeffee;" | Secretion of [http://en.wikipedia/org/wiki/biofilm biofilm]-degrading compounds from ''[http://en.wikipedia.org/wiki/Caulobacter_crescentus Caulobacter crescentus]''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Harvard | Harvard]]<br />
| style="background-color: #eeffee;" | Improved targetting of gene therapy using [http://en.wikipedia.org/wiki/Zinc_finger zinc finger] DNA binding proteins.<br />
|-<br />
| [[Team:Hunter-NYC | Hunter-NYC]]<br />
| Removal of metal ions from contaminated water, using lipase secretion tag.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ITESM Mexico | ITESM Mexico]]<br />
| style="background-color: #eeffee;" | [http://en.wikipedia.org/wiki/Arabinose Arabinose] biosensor with (concentration dependent) output using GFP or CFP.<br />
|-<br />
| [[Team:IvyTech-South Bend | IvyTech-South Bend]]<br />
| Arsenic biosensor with output via smell. May use ''E. coli'' or ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Johns Hopkins | Johns Hopkins]]<br />
| style="background-color: #eeffee;" | Production of vitamins and minerals in ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Lethbridge | Lethbridge]]<br />
| style="background-color: #eeffee;" | Bioremediation e.g. of heavy metals.<br />
|-<br />
| [[Team:McGill | McGill]]<br />
| Control of mammalian cells using light.<br />
|-<br />
| [[Team:Michigan | Michigan]]<br />
| Bind DNA-binding protein to ''E. coli'' membrane; attach to surfaces that have oligonucleotides.<br />
|-<br />
| [[Team:Minnesota | Minnesota]]<br />
| Light-induced silicatein fused to ompA or Ice Nucleation Protein for 3D printing.<br />
|-<br />
| [[Team:Missouri Miners | Missouri Miners]]<br />
| Alteration of [http://ecoliwiki.net/colipedia/index.php/ompR ompR] system to activate at different glucose concentrations.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:MIT | MIT]]<br />
| style="background-color: #eeffee;" | Mammalian [http://en.wikipedia.org/wiki/Juxtacrine_signalling juxtacrine signalling] and [http://en.wikipedia.org/wiki/G_protein-coupled_receptor G protein-coupled receptors].<br />
|-<br />
| [[Team:Nevada | Nevada]]<br />
| Sugar production from cyanobacteria, to feed ''E. coli'' that make biofuel.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Northwestern | Northwestern]]<br />
| style="background-color: #eeffee;" | Detection of ''[http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa Pseudomonas aeruginosa]'' by using its quorum sensing system.<br />
|-<br />
| [[Team:NYC Software | NYC Software]]<br />
| (Software) Genome analysis focusing on radiation tolerance.<br />
|-<br />
| [[Team:NYC Wetware | NYC Wetware]]<br />
| Making ''E. coli'' radiotolerant by using genes from ''[http://en.wikipedia.org/wiki/Deinococcus_radiodurans Deinococcus radiodurans]''.<br />
|-<br />
| [[Team:Panama | Panama]]<br />
| Synthesis of rhamnolipids.<br />
|-<br />
| [[Team:Penn | Penn]]<br />
| Cell-cell communication via light.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Penn State | Penn State]]<br />
| style="background-color: #eeffee;" | Radiation detector using Phage Lambda lytic switch system.<br />
|-<br />
| [[Team:Purdue | Purdue]]<br />
| Bistable toggle switch using [http://en.wikipedia.org/wiki/Phytochrome phytochromes].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Queens Canada | Queens Canada]]<br />
| style="background-color: #eeffee;" | Using [http://en.wikipedia.org/wiki/C._elegans the worm] for sensing pollutants by swimming to them.<br />
|-<br />
| [[Team:Rutgers | Rutgers]]<br />
| Bacteria responding to lasers; addition of numbers in bacteria; BioBrick validation.<br />
<!--<br />
|-<br />
| [[Team:SouthBend-Mishawaka-HS | SouthBend-Mishawaka-HS]]<br />
| Detect ''[http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa Pseudomonas aeruginosa]'' and report by lux.<br />
|-<br />
| [[Team:SouthBend-Mishawaka-HS-2]]<br />
| Arsenic biosensor; report with GFP or an odour.<br />
--><br />
|-<br />
| [[Team:Tec-Monterrey | Tec-Monterrey]]<br />
| Production of high fructose syrup using membrane-bound fusion proteins.<br />
|-<br />
| [[Team:Toronto | Toronto]]<br />
| Incorporating a magnetosome system into ''E. coli?''<br />
<!--<br />
|-<br />
| [[Team:TorontoMaRSDiscovery | TorontoMaRSDiscovery]]<br />
|<br />
--><br />
|-<br />
| [[Team:UANL Mty-Mexico | UANL Mty-Mexico]]<br />
| Logic gates taking light signals as inputs.<br />
|-<br />
| [[Team:UCSF | UCSF]]<br />
| Production of biofilms with ''S. cerevisiae'', by cell display of adhesive proteins.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UC Davis | UC Davis]]<br />
| style="background-color: #eeffee;" | Mutagenesis on promoters and repressors to produce new behaviours.<br />
|-<br />
| [[Team:UIUC-Illinois | UIUC-Illinois]]<br />
| Different plasmids in a cell; choose which is active by making one go to high copy number.<br />
|-<br />
| [[Team:UNAM-Genomics Mexico | UNAM-Genomics Mexico]]<br />
| Hydrogen production in ''[http://en.wikipedia.org/wiki/Rhizobium_etli Rhizobium etli]'' in ''[http://en.wikipedia.org/wiki/Phaseolus_vulgaris Phaseolus vulgaris]''.<br />
|-<br />
| [[Team:UNAM-ITESM Mexico City | UNAM-ITESM Mexico City]]<br />
| Rubber-degrading bacteria.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UNICAMP-EMSE Brazil | UNICAMP-EMSE Brazil]]<br />
| style="background-color: #eeffee;" | Detect mammal's stress by [http://en.wikipedia.org/wiki/Catecholamine catecholamines] and [http://en.wikipedia.org/wiki/Nitric_oxide nitric oxide]; regulate it with [http://en.wikipedia.org/wiki/Cytokine cytokines].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:uOttawa | uOttawa]]<br />
| style="background-color: #eeffee;" | Improving ''S. cerevisiae'' for use with BioBricks.<br />
|-<br />
| [[Team:USC | USC]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
|-<br />
| [[Team:Utah State | Utah State]]<br />
| Production of valuable compounds using the cyanobacterium ''[http://en.wikipedia.org/wiki/Synechocystis Synechocystis]''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UTP-Panama | UTP-Panama]]<br />
| style="background-color: #eeffee;" | Various.<br />
|-<br />
| [[Team:UT Dallas | UT Dallas]]<br />
| Repair of human tissue using bacteria.<br />
|-<br />
| [[Team:VCU | VCU]]<br />
| Various projects involving the cyanobacterium ''[http://en.wikipedia.org/wiki/Synechococcus Synechococcus elongatus]''.<br />
|-<br />
| [[Team:Virginia | Virginia]]<br />
| Using ''S. cerevisiae'' to produce factors which heal human wounds.<br />
|-<br />
| [[Team:Virginia Tech | Virginia Tech]]<br />
| Fluorescent proteins that fold and degrade quickly, to be used as reporters.<br />
<!--<br />
|-<br />
| [[Team:WarrenCIndpls IN-HS | WarrenCIndpls IN-HS]]<br />
| Metal biosensor in ''S. cerevisiae''.<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Washington | Washington]]<br />
| style="background-color: #eeffee;" | Alkanes in ''E. coli''; luciferase in yeast; [http://en.wikipedia.org/wiki/Gluten gluten]-cleaving enzyme; [http://en.wikipedia.org/wiki/Magnetosome magnetosomes] in ''E. coli''.<br />
|-<br />
| [[Team:WashU | WashU]]<br />
| [http://en.wikipedia.org/wiki/Carotene B-Carotene] and [http://en.wikipedia.org/wiki/Ionone B-Ionone] production in ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Waterloo | Waterloo]]<br />
| style="background-color: #eeffee;" | Creation of ribozymes that will excise out of an RNA transcript.<br />
|-<br />
| [[Team:West Point | West Point]]<br />
| Detect ''Vibrio cholerae'' by letting it lyse ''E. coli'', releasing &beta;-galactosidase.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Wisconsin-Madison | Wisconsin-Madison]]<br />
| style="background-color: #eeffee;" | Biosensors to detect biofuels?<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Yale | Yale]]<br />
| style="background-color: #eeffee;" | Production of antifreeze using ''E. coli'' and a gene from the ''Rhagium inquisitor'' beetle.<br />
|-<br />
| <span style="font-size: 150%;">'''Asia'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ArtScienceBangalore | ArtScienceBangalore]]<br />
| style="background-color: #eeffee;" | Environmental mapping / metagenomics<br />
|-<br />
| [[Team:CBNU-Korea | CBNU-Korea]]<br />
| (Software) Synthesising a minimal chromosome.<br />
<!--<br />
|-<br />
| [[Team:CTGU-Yichang | CTGU-Yichang]]<br />
|<br />
--><br />
|-<br />
| [[Team:Fudan-Shanghai | Fudan-Shanghai]]<br />
| Nitrate detection; switching between different colour production; something else.<br />
|-<br />
| [[Team:HIT-Harbin | HIT-Harbin]]<br />
| Yoghurt bacteria that stop producing acid once the yoghurt is acidic enough.<br />
|-<br />
| [[Team:HKU-Hong Kong | HKU-Hong Kong]]<br />
| Silencing specific genes with a modified histone-like nucleoid structuring protein.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:HKUST-Hong Kong | HKUST-Hong Kong]]<br />
| style="background-color: #eeffee;" | Degrading [http://en.wikipedia.org/wiki/Indole indole] using toluene-4-monooxygenase, to boost antibiotic susceptibility.<br />
|-<br />
| [[Team:HokkaidoU Japan | HokkaidoU Japan]]<br />
| Type III secretion system to inject stuff into eukaryotic cells.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Hong Kong-CUHK | Hong Kong-CUHK]]<br />
| style="background-color: #eeffee;" | Light-driven ion pump to produce electricity.<br />
<!--<br />
|-<br />
| [[Team:HSU | HSU]]<br />
|<br />
--><br />
|-<br />
| [[Team:HUST-China | HUST-China]]<br />
| (Software?) Modification of gut-colonising bacteria to degrade alcohol; prevent drunkenness.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:IIT Madras | IIT Madras]]<br />
| style="background-color: #eeffee;" | Modular biosensors.<br />
|-<br />
| [[Team:KAIST-Korea | KAIST-Korea]]<br />
| Artistic ''E. coli'', expressing fluorescence in response to quorum sensing molecules.<br />
|-<br />
| [[Team:KAIT Japan | KAIT Japan]]<br />
| Colony-colony interaction and quorum sensing inhibition.<br />
|-<br />
| [[Team:KIT-Kyoto | KIT-Kyoto]]<br />
| Using quorum sensing to turn on and off GFP expression for aesthetic purposes.<br />
|-<br />
| [[Team:Korea U Seoul | Korea U Seoul]]<br />
| Production of [http://en.wikipedia.org/wiki/Alkane alkanes] from glucose.<br />
|-<br />
| [[Team:Kyoto | Kyoto]]<br />
| Attracting insects with light, trapping them with gum, and digesting them.<br />
|-<br />
| [[Team:Macquarie Australia | Macquarie Australia]]<br />
| "Bacterial light switch" involving [http://en.wikipedia.org/wiki/Phytochrome bacteriaphytochrome] and [http://en.wikipedia.org/wiki/Heme_oxygenase heme oxygenase].<br />
<!--<br />
|-<br />
| [[Team:Nanjing | Nanjing]]<br />
|<br />
--><br />
|-<br />
| [[Team:NCTU Formosa | NCTU Formosa]]<br />
| Temperature controlled expression; testing with [http://en.wikipedia.org/wiki/Carotenoid carotenoid], violacein, and [http://en.wikipedia.org/wiki/Butanol butanol] synthesis.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:NYMU-Taipei | NYMU-Taipei]]<br />
| style="background-color: #eeffee;" | Something involving magnetosomes to transduce a signal; also DNA for information storage.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Osaka | Osaka]]<br />
| style="background-color: #eeffee;" | Radiation dosimeter using DNA repair systems to detect radiation.<br />
|-<br />
| [[Team:OUC-China | OUC-China]]<br />
| Promotion and inhibition of bacterial strains by each other.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Peking R | Peking R]]<br />
| style="background-color: #eeffee;" | Something involving [http://en.wikipedia.org/wiki/Riboswitch riboswitches] and synthetic ribosome binding sites.<br />
|-<br />
| [[Team:Peking S | Peking S]]<br />
| Something with cell-cell communication.<br />
<!--<br />
|-<br />
| [[Team:Rajasthan | Rajasthan]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:SJTU-BioX-Shanghai | SJTU-BioX-Shanghai]]<br />
| style="background-color: #eeffee;" | Translational control.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:SYSU-China | SYSU-China]]<br />
| style="background-color: #eeffee;" | Bacteria that move towards ionising radiation and absorb radioisotopes.<br />
|-<br />
| [[Team:Tianjin | Tianjin]]<br />
| Adjusting the yeast TOR (Target Of Rapamycin) protein to aid survival in [http://en.wikipedia.org/wiki/Lignocellulose lignocellulose].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tokyo-NoKoGen | Tokyo-NoKoGen]]<br />
| style="background-color: #eeffee;" | Bacteria that absorb radioactive [http://en.wikipedia.org/wiki/Caesium caesium].<br />
|-<br />
| [[Team:Tokyo Metropolitan | Tokyo Metropolitan]]<br />
| Killer ''E. coli'' that swim to some "target" and kill it.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tokyo Tech | Tokyo Tech]]<br />
| style="background-color: #eeffee;" | Rock/Paper/Scissors bacteria; urea production; [http://en.wikipedia.org/wiki/Isoprene isoprene] for cloud seeding.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tsinghua | Tsinghua]]<br />
| style="background-color: #eeffee;" | Something involving movement of proteins.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tsinghua-A | Tsinghua-A]]<br />
| style="background-color: #eeffee;" | Oscillation between red and green fluorescence, using quorum sensing.<br />
|-<br />
| [[Team:TzuChiU Formosa | TzuChiU Formosa]]<br />
| Conversion of CO to CO2 using [http://en.wikipedia.org/wiki/Carbon_monoxide_dehydrogenase carbon monoxide dehydrogenase] in ''[http://en.wikipedia.org/wiki/Rhodospirillum_rubrum Rhodospirillum rubrum]''.<br />
|-<br />
| [[Team:UNIST Korea | UNIST Korea]]<br />
| An organism which will kill itself upon escape from the lab.<br />
|-<br />
| [[Team:UQ-Australia | UQ-Australia]]<br />
| 24-hour bacterial oscillator.<br />
|-<br />
| [[Team:UST-Beijing | UST-Beijing]]<br />
| Bile acid sensor involving [http://en.wikipedia.org/wiki/Liver_X_receptor_beta LXR-&Beta;].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:USTC-China | USTC-China]]<br />
| style="background-color: #eeffee;" | "Self-organized bacteria"; project involves [http://en.wikipedia.org/wiki/Riboswitch riboswitches].<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:USTC-Software | USTC-Software]]<br />
| style="background-color: #ffffee;" | (Software) Visual tool for analysing dynamics of biological systems.<br />
|-<br />
| [[Team:UT-Tokyo | UT-Tokyo]]<br />
| Bacteria that respond to stress by creating a signal, which other bacteria swim towards.<br />
|-<br />
| [[Team:VIT Vellore | VIT Vellore]]<br />
| Enteric bacteria producing drugs or other compounds for the body.<br />
|-<br />
| [[Team:Waseda-Japan | Waseda-Japan]]<br />
| Responding to different colours of light, detected by CcaS and CcaR.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:WHU-China | WHU-China]]<br />
| style="background-color: #eeffee;" | Bacterial communication with light; also colour photography using ''E. coli''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:XMU-China | XMU-China]]<br />
| style="background-color: #eeffee;" | Control of cell density with a killer gene.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ZJU-China | ZJU-China]]<br />
| style="background-color: #eeffee;" | Using different oxygen levels in biofilms to control different expression patterns.<br />
|-<br />
| <span style="font-size: 150%;">'''Europe'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| [[Team:Amsterdam | Amsterdam]]<br />
| Make ''E. coli'' psychrophilic (cold loving).<br />
<!--<br />
|-<br />
| [[Team:BCCS-Bristol | BCCS-Bristol]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Bielefeld-Germany | Bielefeld-Germany]]<br />
| style="background-color: #eeffee;" | Cell-free biosensor for bisphenol A.<br />
|-<br />
| [[Team:Bilkent UNAM Turkey | Bilkent UNAM Turkey]]<br />
| Production of protein from algae e.g. ''[http://en.wikipedia.org/wiki/Chlamydomonas_reinhardtii Chlamydomonas reinhardtii]''.<br />
|-<br />
| [[Team:Cambridge | Cambridge]]<br />
| Bacterial expression of [http://en.wikipedia.org/wiki/Reflectin reflectins] from ''Loligo'' squid.<br />
|-<br />
| [[Team:CongoDRC-Bel Campus | CongoDRC-Bel Campus]]<br />
| Vaccine for ''[http://en.wikipedia.org/wiki/Mycobacterium_ulcerans Mycobacterium ulcerans]''.<br />
|-<br />
| [[Team:Copenhagen | Copenhagen]]<br />
| Removal of pharmaceutical products from water with [http://en.wikipedia.org/wiki/Cytochrome_P450 cytochrome P450].<br />
|-<br />
| [[Team:Debrecen Hungary | Debrecen Hungary]]<br />
| Something with Nuclear Hormone Receptors: ligand activated transcription factors.<br />
|-<br />
| [[Team:DTU-Denmark | DTU-Denmark]]<br />
| Using sRNA for post-transcriptional regulation.<br />
|-<br />
| [[Team:DTU-Denmark-2 | DTU-Denmark-2]]<br />
| A new assembly method using uracil-excision based cloning.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Dundee | Dundee]]<br />
| style="background-color: #eeffee;" | Creation of [http://en.wikipedia.org/wiki/Bacterial_microcompartment bacterial microcompartments].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Edinburgh | Edinburgh]]<br />
| style="background-color: #eeffee;" | Display of cellulases on M13 (via pVIII) or on cell surface (via Ice Nucleation Protein).<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:ENSPS-Strasbourg | ENSPS-Strasbourg]]<br />
| style="background-color: #ffffee;" | (Software) GUI for designing synthetic systems.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:EPF-Lausanne | EPF-Lausanne]]<br />
| style="background-color: #eeffee;" | Creation of new [http://en.wikipedia.org/wiki/Transcription_factor transcription factors].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ETH Zurich | ETH Zurich]]<br />
| style="background-color: #eeffee;" | Biological smoke detector by detection of [http://en.wikipedia.org/wiki/Acetaldehyde acetaldehyde].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Fatih Turkey | Fatih Turkey]]<br />
| style="background-color: #eeffee;" | Using ''[http://en.wikipedia.org/wiki/B._subtilis B. subtilis]'' to detect ''E. coli?''<br />
|-<br />
| [[Team:Freiburg | Freiburg]]<br />
| A cheaper system for protein purification.<br />
|-<br />
| [[Team:Glasgow | Glasgow]]<br />
| Light-controlled expression of bacteria inside biofilms.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Grenoble | Grenoble]]<br />
| style="background-color: #eeffee;" | Determination of metal concentration by growing reporter bacteria on an IPTG gradient.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Groningen | Groningen]]<br />
| style="background-color: #eeffee;" | Remember that an input has occurred; use a biological [http://en.wikipedia.org/wiki/AND_gate AND gate] to count occurrences.<br />
<!--<br />
|-<br />
| [[Team:HU-Micro | HU-Micro]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Imperial College London | Imperial College London]]<br />
| style="background-color: #eeffee;" | Something involving [http://en.wikipedia.org/wiki/Auxin auxin], and dealing with soil erosion.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:KULeuven | KULeuven]]<br />
| style="background-color: #eeffee;" | Creation and prevention of ice with Ice Nucleation Protein and Anti Freeze Protein.<br />
|-<br />
| [[Team:LMU-Munich | LMU-Munich]]<br />
| Metal biosensors with a focus on quantification.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Lyon-INSA-ENS | Lyon-INSA-ENS]]<br />
| style="background-color: #eeffee;" | Biofilter for radioactive waste.<br />
|-<br />
| [[Team:METU-Ankara | METU-Ankara]]<br />
| Methane biosensor and methane conversion into methanol.<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:METU-BIN Ankara | METU-BIN Ankara]]<br />
| style="background-color: #ffffee;" | (Software) Web based tool for construct planning.<br />
|-<br />
| [[Team:METU Turkey SoftLab | METU Turkey SoftLab]]<br />
| (Software) "BioGuide".<br />
|-<br />
| [[Team:Nairobi | Nairobi]]<br />
| Engineering a fungus to kill insects.<br />
|-<br />
| [[Team:NTNU Trondheim | NTNU Trondheim]]<br />
| Detection of bacterial stress; based on the ''E. coli'' "[http://en.wikipedia.org/wiki/Stringent_response stringent response]" which produces ppGpp.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Paris Bettencourt | Paris Bettencourt]]<br />
| style="background-color: #eeffee;" | Passing signals e.g. RNA from cell to cell via nanotubes.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Potsdam Bioware | Potsdam Bioware]]<br />
| style="background-color: #eeffee;" | Directed evolution of cyclic peptides for therapeutics. Use phage display, error-prone PCR.<br />
|-<br />
| [[Team:Sevilla | Sevilla]]<br />
| Biological circuits using multiple different genotypes at once.<br />
<!--<br />
|-<br />
| [[Team:Strathclyde Glasgow | Strathclyde Glasgow]]<br />
|<br />
--><br />
|-<br />
| [[Team:St Andrews | St Andrews]]<br />
| Production of anti-microbial peptides in ''E. coli'' to kill bacteria.<br />
|-<br />
| [[Team:TU-Delft | TU-Delft]]<br />
| Expressing mussel glue protein in ''E. coli'' to attach to stuff, with inducible detachment.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:TU Munich | TU Munich]]<br />
| style="background-color: #eeffee;" | 3D printing by immobilising ''E. coli'' in a gel; turn on genes iff 2 different colour lasers hit.<br />
|-<br />
| [[Team:UCL London | UCL London]]<br />
| Using [http://en.wikipedia.org/wiki/DNA_gyrase gyrase] to increase supercoiling of plasmids.<br />
|-<br />
| [[Team:UEA-JIC Norwich | UEA-JIC Norwich]]<br />
| Glow-in-the-dark bacteria, protists, and moss.<br />
|-<br />
| [[Team:ULB-Brussels | ULB-Brussels]]<br />
| Tools for inserting or deleting genes in the main ''E. coli'' chromosome. <br />
|-<br />
| [[Team:UNIPV-Pavia | UNIPV-Pavia]]<br />
| Regulating a quorum sensing molecule by negative feedback.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UNITS Trieste | UNITS Trieste]]<br />
| style="background-color: #eeffee;" | Synthetic biome where bacteria and eukaryotic cells depend on each other to survive.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UPO-Sevilla | UPO-Sevilla]]<br />
| style="background-color: #eeffee;" | Biological memory with bistable toggle switches.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Uppsala-Sweden | Uppsala-Sweden]]<br />
| style="background-color: #eeffee;" | Light-induced gene expression.<br />
<!--<br />
|-<br />
| [[Team:UTP-Poland | UTP-Poland]]<br />
|<br />
--><br />
|-<br />
| [[Team:Valencia | Valencia]]<br />
| Production of antimicrobial peptides to clean up drinking water.<br />
|-<br />
| [[Team:Wageningen UR | Wageningen UR]]<br />
| Oscillating, synchronised gene expression in ''E. coli'', and communication along fungal [http://en.wikipedia.org/wiki/Hypha hyphae].<br />
|-<br />
| [[Team:Warsaw | Warsaw]]<br />
| Cell-free cloning using [http://www.neb.com/nebecomm/products/productM0269.asp phi29 DNA polymerase]; also insertion of stuff into main genome.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:WITS-CSIR SA | WITS-CSIR SA]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that search for a ligand then, upon finding it, return to a point of origin and report.<br />
|}<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/AttributionsTeam:Edinburgh/Attributions2011-11-15T13:26:54Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_attributions');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Attributions</p><br />
<br />
<br />
<font color="#f36b21">The rest of the team would like to acknowledge the hard work done by the wetlab biologists, Mun Ching Lee and Sylvia Ispasanie, who often worked for periods over 12 hours, and often 7 days a week.</font><br />
<br />
<br />
; <font color="#f36b21">Phage/cell display systems</font><br />
: '''Mun Ching Lee:''' planning, biology wetwork<br />
: '''Sylvia Ispasanie:''' planning, biology wetwork<br />
: '''Allan Crossman:''' planning, documentation<br />
: Supervised and assisted by '''Chris French''' and '''Eugene Fletcher'''<br />
<br />
<br />
; <font color="#f36b21">BioBricks</font><br />
: '''Sylvia Ispasanie:''' planning, biology wetwork<br />
: '''Mun Ching Lee:''' planning, biology wetwork<br />
: '''Allan Crossman:''' primers, sequence verification, Registry updates<br />
: Supervised and assisted by '''Eugene Fletcher''' and '''Chris French'''<br />
<br />
<br />
; <font color="#f36b21">BioSandwich assembly</font><br />
: '''Chris French:''' concept, testing, documentation<br />
: '''Sylvia Ispasanie:''' testing, implementation<br />
: '''Mun Ching Lee:''' testing, implementation<br />
: '''Allan Crossman:''' documentation<br />
<br />
<br />
; <font color="#f36b21">Modelling and software</font><br />
: '''Di Li:''' phage replication model, MATLAB cellulase model<br />
: '''Lukasz Kopec:''' Kappa cellulase models, genetic stability tool<br />
: '''Yassen Abbas:''' MATLAB cellulase model<br />
: '''Allan Crossman:''' C cellulase model, artificial selection model<br />
: Advised by '''John Roger Wilson-Kanamori''' and '''Vincent Danos'''<br />
<br />
<br />
; <font color="#f36b21">Biorefinery concept</font><br />
: '''Yassen Abbas:''' plant design, economics, documentation, life cycle analysis<br />
<br />
<br />
; <font color="#f36b21">Interviews</font><br />
: '''Fionn Tynan-O'Mahony:''' interviews, interview design, analysis<br />
: '''Yassen Abbas:''' interviews, interview design, analysis<br />
: '''Allan Crossman:''' interviews, analysis<br />
: Advised by '''Emma Frow''' and '''Jane Calvert'''<br />
<br />
<br />
; <font color="#f36b21">Graphic design</font><br />
: '''Fionn Tynan-O'Mahony:''' most graphics<br />
<br />
<br />
; <font color="#f36b21">Posters</font><br />
: '''Fionn Tynan-O'Mahony:''' graphics<br />
: '''Yassen Abbas:''' design and layout<br />
<br />
<br />
; <font color="#f36b21">Wiki</font><br />
: '''Fionn Tynan-O'Mahony:''' overall design<br />
: '''Lukasz Kopec:''' coding<br />
: Other team members contributed to pages specific to their own areas<br />
<br />
<br />
; <font color="#f36b21">Speeches and talks</font><br />
: '''Yassen Abbas:''' biology<br />
: '''Lukasz Kopec:''' modelling<br />
: '''Mun Ching Lee:''' biology <br />
: '''Sylvia Ispasanie:''' biology<br />
: '''Fionn Tynan-O'Mahony:''' human practices<br />
<br />
<br />
----<br />
<br />
<br />
; <font color="#f36b21">Images</font><br />
: Piazza della Signoria photo by '''Samuli Lintula''' ([http://en.wikipedia.org/wiki/File:Piazza_della_Signoria.jpg source]). Published under [http://creativecommons.org/licenses/by/2.5/deed.en Creative Commons Attribution 2.5 Generic license].<br />
<br />
<br />
; <font color="#f36b21">Computing</font><br />
: This project has made use of the resources provided by the '''Edinburgh Compute and Data Facility''' (ECDF, [http://www.ecdf.ed.ac.uk/ www.ecdf.ed.ac.uk]). The ECDF is partially supported by the eDIKT initiative ([http://www.edikt.org.uk www.edikt.org.uk]).<br />
<br />
<br />
; <font color="#f36b21">Parts</font><br />
: BioBricks entered into the Registry by us but created in whole or in part by others are:<br />
: [http://partsregistry.org/Part:BBa_K523005 BBa_K523005]; [http://partsregistry.org/Part:BBa_K523015 BBa_K523015]; [http://partsregistry.org/Part:BBa_K523016 BBa_K523016]; [http://partsregistry.org/Part:BBa_K523017 BBa_K523017]<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/AttributionsTeam:Edinburgh/Attributions2011-11-15T13:26:32Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_attributions');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Attributions</p><br />
<br />
<br />
<font color="red">The rest of the team would like to acknowledge the hard work done by the wetlab biologists, Mun Ching Lee and Sylvia Ispasanie, who often worked for periods over 12 hours, and often 7 days a week.</font><br />
<br />
<br />
; <font color="#f36b21">Phage/cell display systems</font><br />
: '''Mun Ching Lee:''' planning, biology wetwork<br />
: '''Sylvia Ispasanie:''' planning, biology wetwork<br />
: '''Allan Crossman:''' planning, documentation<br />
: Supervised and assisted by '''Chris French''' and '''Eugene Fletcher'''<br />
<br />
<br />
; <font color="#f36b21">BioBricks</font><br />
: '''Sylvia Ispasanie:''' planning, biology wetwork<br />
: '''Mun Ching Lee:''' planning, biology wetwork<br />
: '''Allan Crossman:''' primers, sequence verification, Registry updates<br />
: Supervised and assisted by '''Eugene Fletcher''' and '''Chris French'''<br />
<br />
<br />
; <font color="#f36b21">BioSandwich assembly</font><br />
: '''Chris French:''' concept, testing, documentation<br />
: '''Sylvia Ispasanie:''' testing, implementation<br />
: '''Mun Ching Lee:''' testing, implementation<br />
: '''Allan Crossman:''' documentation<br />
<br />
<br />
; <font color="#f36b21">Modelling and software</font><br />
: '''Di Li:''' phage replication model, MATLAB cellulase model<br />
: '''Lukasz Kopec:''' Kappa cellulase models, genetic stability tool<br />
: '''Yassen Abbas:''' MATLAB cellulase model<br />
: '''Allan Crossman:''' C cellulase model, artificial selection model<br />
: Advised by '''John Roger Wilson-Kanamori''' and '''Vincent Danos'''<br />
<br />
<br />
; <font color="#f36b21">Biorefinery concept</font><br />
: '''Yassen Abbas:''' plant design, economics, documentation, life cycle analysis<br />
<br />
<br />
; <font color="#f36b21">Interviews</font><br />
: '''Fionn Tynan-O'Mahony:''' interviews, interview design, analysis<br />
: '''Yassen Abbas:''' interviews, interview design, analysis<br />
: '''Allan Crossman:''' interviews, analysis<br />
: Advised by '''Emma Frow''' and '''Jane Calvert'''<br />
<br />
<br />
; <font color="#f36b21">Graphic design</font><br />
: '''Fionn Tynan-O'Mahony:''' most graphics<br />
<br />
<br />
; <font color="#f36b21">Posters</font><br />
: '''Fionn Tynan-O'Mahony:''' graphics<br />
: '''Yassen Abbas:''' design and layout<br />
<br />
<br />
; <font color="#f36b21">Wiki</font><br />
: '''Fionn Tynan-O'Mahony:''' overall design<br />
: '''Lukasz Kopec:''' coding<br />
: Other team members contributed to pages specific to their own areas<br />
<br />
<br />
; <font color="#f36b21">Speeches and talks</font><br />
: '''Yassen Abbas:''' biology<br />
: '''Lukasz Kopec:''' modelling<br />
: '''Mun Ching Lee:''' biology <br />
: '''Sylvia Ispasanie:''' biology<br />
: '''Fionn Tynan-O'Mahony:''' human practices<br />
<br />
<br />
----<br />
<br />
<br />
; <font color="#f36b21">Images</font><br />
: Piazza della Signoria photo by '''Samuli Lintula''' ([http://en.wikipedia.org/wiki/File:Piazza_della_Signoria.jpg source]). Published under [http://creativecommons.org/licenses/by/2.5/deed.en Creative Commons Attribution 2.5 Generic license].<br />
<br />
<br />
; <font color="#f36b21">Computing</font><br />
: This project has made use of the resources provided by the '''Edinburgh Compute and Data Facility''' (ECDF, [http://www.ecdf.ed.ac.uk/ www.ecdf.ed.ac.uk]). The ECDF is partially supported by the eDIKT initiative ([http://www.edikt.org.uk www.edikt.org.uk]).<br />
<br />
<br />
; <font color="#f36b21">Parts</font><br />
: BioBricks entered into the Registry by us but created in whole or in part by others are:<br />
: [http://partsregistry.org/Part:BBa_K523005 BBa_K523005]; [http://partsregistry.org/Part:BBa_K523015 BBa_K523015]; [http://partsregistry.org/Part:BBa_K523016 BBa_K523016]; [http://partsregistry.org/Part:BBa_K523017 BBa_K523017]<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/TeamTeam:Edinburgh/Team2011-11-15T13:24:47Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_people');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Team</p><br />
<span class="hardword" id="help">[[File:Group_photo.JPG|200px|thumb|right|Team Synergy at the European jamboree.]]</span><br />
<br />
[[File:Igem_circle.JPG|200px|thumb|right|The art of synergistic napping.]]<br />
<br />
"There's no I in iGEM" -- Yassen<br />
<br />
The official Edinburgh team profile is [https://igem.org/Team.cgi?id=523 here].<br />
<div class="teammembers"><br />
* <font color="#f36b21">'''Undergraduate Students'''</font><br />
** '''Yassen Abbas''' &mdash; chemical engineering<br />
** '''Allan Crossman''' &mdash; evolutionary biology<br />
** '''Clare Gibson''' &mdash; sociology<br />
** '''Sylvia Ispasanie''' &mdash; biotechnology<br />
** '''Lukasz Kopec''' &mdash; cognitive science<br />
** '''Mun Ching Lee''' &mdash; biotechnology<br />
** '''Di Li''' &mdash; electrical engineering<br />
** '''Fionn Tynan-O'Mahony''' &mdash; design<br />
</div><br />
* <font color="#f36b21">'''Advisors'''</font><br />
** '''Tosif Ahamed''' &mdash; cognitive science<br />
** '''Eugene Fletcher''' &mdash; biotechnology<br />
** '''John Roger Wilson-Kanamori''' &mdash; systems biology<br />
* <font color="#f36b21">'''Instructors'''</font><br />
** '''Dr Jane Calvert''' &mdash; sociology of life sciences<br />
** '''Professor Vincent Danos''' &mdash; systems biology<br />
** '''Dr Alistair Elfick''' &mdash; biomedical engineering<br />
** '''Dr Chris French''' &mdash; biotechnology<br />
** '''Dr Emma Frow''' &mdash; science and technology studies<br />
* <font color="#f36b21">'''Observer'''</font><br />
** '''Yuhua Hu''' &mdash; e-learning<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Cellulases_(MATLAB_model)Team:Edinburgh/Cellulases (MATLAB model)2011-10-28T20:05:09Z<p>Allancrossman: /* Results */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('model', 'model_synergymatlab');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Cellulases (MATLAB model)</p><br />
<br />
MATLAB is a general-purpose mathematical tool, developed by [http://www.mathworks.com Mathworks], and commonly used by engineers. Among other things, it can be used to solve ordinary differential equations (ODEs) by numerical integration.<br />
<br />
An attempt was made to use MATLAB to model the degradation of <span class="hardword" id="cellulose">cellulose</span> into glucose in a biorefinery. But accurately predicting how much is converted in the <span class="hardword" id="synergy">synergistic</span> system (where enzymes are kept close together) is difficult without literature to provide the ODEs and the kinetic parameters. Therefore this model only looks at the free floating (non-synergistic) enzyme approach. It is <span class="hardword" id="deterministic">deterministic</span> and is set by a series of initial conditions.<br />
<br />
==Assumptions==<br />
<br />
The mathematical model is based on the ODEs and kinetic parameters outlined in [http://onlinelibrary.wiley.com/doi/10.1021/bp034316x/full Kadam ''et al'' (2004)]. The following are its assumptions and basis:<br />
<br />
* Underlying assumption: cellulose, <span class="hardword" id="cellobiose">cellobiose</span>, and glucose concentrations change continuously with time.<br />
* Rate equations assume enzyme <span class="hardword" id="adsorption">adsorption</span> follows the Langmuir isotherm model.<br />
* Glucose and cellobiose, which are the products of cellulose <span class="hardword" id="hydrolysis">hydrolysis</span>, are assumed to "competitively inhibit enzyme hydrolysis".<br />
* All reactions are assumed to follow the same temperature dependency Arrhenius relationship (shown below). However, in reality it should be different for every enzyme component, "because of their varying degrees of thermostability, with &beta;-glucocidase being the most thermostable. Hence the assumption is a simplification of reality".<br />
* Conversion of cellobiose to glucose follows the <span class="hardword" id="mm">Michaelis-Menten</span> enzyme kinetic model.<br />
<br />
==Equations==<br />
<br />
<br />
===Rate Equations===<br />
<br />
[[File:Edinburgh-Rate-1.png|thumb|center|700px|Cellulose to cellobiose reaction with competitive glucose, cellobiose and xylose inhibition.]]<br />
<br />
[[File:Edinburgh-Rate-2.png|thumb|center|700px|Cellulose to glucose reaction with competitive glucose, cellobiose and xylose inhibition.]]<br />
<br />
[[File:Edinburgh-Rate-3.png|thumb|center|700px|Cellobiose to glucose reaction with competitive glucose, cellibiose and xylose inhibition.]]<br />
<br />
====Constants====<br />
<br />
: k<sub>nr</sub> &mdash; reaction rate constant for reaction n<br />
: E<sub>nB</sub> &mdash; the bound concentration for exo and endo-&beta;-1,4-glucanase for reaction n<br />
: R<sub>s</sub> &mdash; substrate reactivity parameter<br />
: S &mdash; substrate reactivity at a given time (g/kg) <sub>&nbsp;</sub><br />
: G<sub>2</sub> &mdash; concentration of cellobiose<br />
: G &mdash; concentration of glucose <sub>&nbsp;</sub><br />
: X &mdash; xylose concentration <sub>&nbsp;</sub><br />
: K<sub>nIG2</sub> &mdash; inhibition constant for cellobiose at reaction n<br />
: K<sub>nIG</sub> &mdash; inhibition constant for glucose at reaction n<br />
: K<sub>nIX</sub> &mdash; xylose inhibition constant for reaction n<br />
<br />
'''Note:''' For simplicity's sake we have assumed no xylose in the system, therefore X=0.<br />
<br />
===Langmuir Isotherm===<br />
<br />
[[File:Edinburgh Langmuir isotherm.png|thumb|center|700px| The Langmuir Isotherm model mathematically describes enzyme adsorption onto solid cellulose substrates. Even though the Langmuir model is based on uniform binding sites and no interaction between the adsorbing molecules, it is not valid for cellulase adsorption onto cellulose. "Nevertheless the Langmuir formulation remains useful for mathematically describing the phenomenon of enzyme adsorption" ([http://onlinelibrary.wiley.com/doi/10.1021/bp034316x/full Kadam et al, 2004]).]]<br />
<br />
====Constants====<br />
<br />
: exo and endo-&beta;-1,4-glucanase, i=1 <sub>&nbsp;</sub><br />
: &beta;-glucosidase, i=2 <sub>&nbsp;</sub><br />
: E<sub>imax</sub> &mdash; Maximum mass of enzyme that can be absorbed onto a unit of mass substrate<br />
: K<sub>iad</sub> &mdash; Dissociation constant for enzyme i<br />
: E<sub>iF</sub> &mdash; Free enzyme concentration for enzyme i<br />
: S &mdash; Substrate reactivity at a given time (g/kg)<br />
<br />
===Mass Balances===<br />
[[File:Edinburgh cellulose mass balance.png|thumb|center|700px| Cellulose mass balance ]]<br />
<br />
[[File:Edinburgh Cellobiose mass balance.png|thumb|center|700px| Cellobiose mass balance ]]<br />
<br />
[[File:Edinburgh glucose mass balance.png|thumb|center|700px| Glucose mass balance ]]<br />
<br />
===Arrhenius Equation===<br />
[[File:Edinburgh Arhennius mass balance.png|thumb|center|700px| Arrhenius equation is an <span class="hardword" id="empirical">empirical</span> relationship which is used to model the temperature dependent reaction rate constant. Note: T1 is set at 45 &deg;C ]]<br />
<br />
====Constants====<br />
<br />
: K<sub>ir</sub> &mdash; Reaction rate constant of reaction i<br />
: E<sub>ai</sub> &mdash; Activation energy of reaction i<br />
: R &mdash; Universal gas constant<br />
<br />
==Construction of Model==<br />
<br />
The model was constructed using the numerical programme MATLAB. A script file was generated which holds the variable dictionary, constants, temperature dependency equations, the "ODE45" differential equation solver, and the plot command. <br />
<br />
A separate function file to the script is created as script files can only operate on the variables that are coded into their m-files. R<sub>s</sub> (the substrate reactivity parameter) changes at every iteration because it is dependent on the S the substrate concentration at a given time, the substrate being cellulose. Therefore S at the first iteration is S<sub>0</sub>, the initial substrate concentration. At the second iteration S is the previous value calculated by the ODE, and so on. After each step the new value of S is fed into the function file and is used for calculating the reaction rate constant for cellobiose and glucose, etc. <br />
<br />
[[File:Edinburgh-Substrate_reactivity.png|thumb|center|700px| R<sub>s</sub> &mdash; substrate reactivity equation]]<br />
<br />
ODE45 calls on the function file to calculate the rate equations and then substitute them into the respective mass balance. A numerical integration is performed and the results can be seen below. ODE45 is used as it is more accurate than other solvers [http://www.mathworks.co.uk/help/techdoc/ref/ode23.html (according to Mathworks)]. It is based on an explicit <span class="hardword" id="rk">Runge-Kutta formula</span> and is a one-step solver.<br />
<br />
==Results==<br />
<br />
[[File:Edinburgh-Graph_1.png‎|thumb|center|700px| Figure 1: Graph of cellulose degradation over time with maximum &beta;-glucosidase.<br/> Initial conditions: Cellulose - 100 g/kg, Glucose - 0.01 g/kg , Cellobiose - 0.01 g/kg. <br/><br />
Enzymes: Exo/endo-glucanase - 0.01 g/kg, &beta;-glucosidase - 1 g/kg <br/> Temperature 35&deg; C]]<br />
<br />
<br/><br />
<br />
[[File:Edinburgh-Graph_2.png‎|thumb|center|700px| Figure 2: Graph of cellulose degradation over time with maximum Exo/endo-glucanase.<br/> Initial conditions: Cellulose - 100 g/kg, Glucose - 0.01 g/kg , Cellobiose - 0.01 g/kg. <br/><br />
Enzymes: Exo/endo-glucanase - 1 g/kg, &beta;-glucosidase - 0.01 g/kg <br/> Temperature 35&deg; C]]<br />
<br />
Figure 1 is set with &beta;-glucosidase at its maximum concentration and Figure 2 with Exo/endo-glucanase at maximum. This is to compare the effect of certain enzymes on cellulose degradation and glucose production. The result is consistent with what is expected. Exoglucanase chews away at the end of a cellulose chain, producing cellobiose sugars and endoglucanase cuts cellulose chanins in the centre, turning one chain into two. This concurs with the results, with Figure 1 modelling markedly higher amount of cellulose at the minimum amount of exo/endo-glucanase than that of Figure 2. Whereas &beta;-glucosidase cuts cellobiose in half, producing two glucose molecules. Figure 2 which &beta;-glucosidase is at its maximum produces 255.6% more glucose than in Figure 1 with &beta;-glucosidase at its minimum in 60 hours.<br />
<br />
The concentration of cellobiose in Figure 1 keeps low. This is because there is little cellulose converted to cellobiose by Exo/endo-glucanase. Also, if there is any cellobiose, they are all converted to glucose by &beta;-glucosidase. <br />
<br />
[[File:Edinburgh_semilogx3.png‎|thumb|center|700px| Figure 3: Graph of cellulose degradation over time with maximum &beta;-glucosidase.<br/> Initial conditions: Cellulose - 100 g/kg, Glucose - 0.01 g/kg , Cellobiose - 0.01 g/kg. <br/><br />
Enzymes: Exo/endo-glucanase - 1 g/kg, &beta;-glucosidase - 0.01 g/kg <br/> Temperature 35&deg; C. The x-axis is set to semilog.]]<br />
<br />
Figure 3 is under the same conditions as Figure 2, but its x-axis is set to a semilog scale to illustrate what happens over a longer period of time. The effect of high &beta;-glucosidase can better be seen with the complete conversion of cellobiose to glucose.<br />
<br />
(We'd like to thank the ETH Zurich team for submitting some bugfixes to the simulation that led to this figure; where previously it violated the laws of physics, now it does not!)<br />
<br />
==Download MATLAB file==<br />
<br />
You can download the ready model as a .zip file:<br />
<br />
<html><center><a href="/File:Edinburgh_MATLAB_Cellulose_degradation.zip‎‎" class="nounderline"><img src="/wiki/images/5/59/Edinburgh-spinning-logo.gif" alt="Download the model file here"/></a></center></html><br />
<br />
==References== <br />
<br />
* Kadam KL, Rydholm EC, McMillan JD (2004) [http://onlinelibrary.wiley.com/doi/10.1021/bp034316x/full Development and Validation of a Kinetic Model for Enzymatic Saccharification of Lignocellulosic Biomass]. ''Biotechnology Progress'' '''20'''(3): 698–705 (doi: 10.1021/bp034316x).<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Cellulases_(MATLAB_model)Team:Edinburgh/Cellulases (MATLAB model)2011-10-28T20:04:23Z<p>Allancrossman: /* Results */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('model', 'model_synergymatlab');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Cellulases (MATLAB model)</p><br />
<br />
MATLAB is a general-purpose mathematical tool, developed by [http://www.mathworks.com Mathworks], and commonly used by engineers. Among other things, it can be used to solve ordinary differential equations (ODEs) by numerical integration.<br />
<br />
An attempt was made to use MATLAB to model the degradation of <span class="hardword" id="cellulose">cellulose</span> into glucose in a biorefinery. But accurately predicting how much is converted in the <span class="hardword" id="synergy">synergistic</span> system (where enzymes are kept close together) is difficult without literature to provide the ODEs and the kinetic parameters. Therefore this model only looks at the free floating (non-synergistic) enzyme approach. It is <span class="hardword" id="deterministic">deterministic</span> and is set by a series of initial conditions.<br />
<br />
==Assumptions==<br />
<br />
The mathematical model is based on the ODEs and kinetic parameters outlined in [http://onlinelibrary.wiley.com/doi/10.1021/bp034316x/full Kadam ''et al'' (2004)]. The following are its assumptions and basis:<br />
<br />
* Underlying assumption: cellulose, <span class="hardword" id="cellobiose">cellobiose</span>, and glucose concentrations change continuously with time.<br />
* Rate equations assume enzyme <span class="hardword" id="adsorption">adsorption</span> follows the Langmuir isotherm model.<br />
* Glucose and cellobiose, which are the products of cellulose <span class="hardword" id="hydrolysis">hydrolysis</span>, are assumed to "competitively inhibit enzyme hydrolysis".<br />
* All reactions are assumed to follow the same temperature dependency Arrhenius relationship (shown below). However, in reality it should be different for every enzyme component, "because of their varying degrees of thermostability, with &beta;-glucocidase being the most thermostable. Hence the assumption is a simplification of reality".<br />
* Conversion of cellobiose to glucose follows the <span class="hardword" id="mm">Michaelis-Menten</span> enzyme kinetic model.<br />
<br />
==Equations==<br />
<br />
<br />
===Rate Equations===<br />
<br />
[[File:Edinburgh-Rate-1.png|thumb|center|700px|Cellulose to cellobiose reaction with competitive glucose, cellobiose and xylose inhibition.]]<br />
<br />
[[File:Edinburgh-Rate-2.png|thumb|center|700px|Cellulose to glucose reaction with competitive glucose, cellobiose and xylose inhibition.]]<br />
<br />
[[File:Edinburgh-Rate-3.png|thumb|center|700px|Cellobiose to glucose reaction with competitive glucose, cellibiose and xylose inhibition.]]<br />
<br />
====Constants====<br />
<br />
: k<sub>nr</sub> &mdash; reaction rate constant for reaction n<br />
: E<sub>nB</sub> &mdash; the bound concentration for exo and endo-&beta;-1,4-glucanase for reaction n<br />
: R<sub>s</sub> &mdash; substrate reactivity parameter<br />
: S &mdash; substrate reactivity at a given time (g/kg) <sub>&nbsp;</sub><br />
: G<sub>2</sub> &mdash; concentration of cellobiose<br />
: G &mdash; concentration of glucose <sub>&nbsp;</sub><br />
: X &mdash; xylose concentration <sub>&nbsp;</sub><br />
: K<sub>nIG2</sub> &mdash; inhibition constant for cellobiose at reaction n<br />
: K<sub>nIG</sub> &mdash; inhibition constant for glucose at reaction n<br />
: K<sub>nIX</sub> &mdash; xylose inhibition constant for reaction n<br />
<br />
'''Note:''' For simplicity's sake we have assumed no xylose in the system, therefore X=0.<br />
<br />
===Langmuir Isotherm===<br />
<br />
[[File:Edinburgh Langmuir isotherm.png|thumb|center|700px| The Langmuir Isotherm model mathematically describes enzyme adsorption onto solid cellulose substrates. Even though the Langmuir model is based on uniform binding sites and no interaction between the adsorbing molecules, it is not valid for cellulase adsorption onto cellulose. "Nevertheless the Langmuir formulation remains useful for mathematically describing the phenomenon of enzyme adsorption" ([http://onlinelibrary.wiley.com/doi/10.1021/bp034316x/full Kadam et al, 2004]).]]<br />
<br />
====Constants====<br />
<br />
: exo and endo-&beta;-1,4-glucanase, i=1 <sub>&nbsp;</sub><br />
: &beta;-glucosidase, i=2 <sub>&nbsp;</sub><br />
: E<sub>imax</sub> &mdash; Maximum mass of enzyme that can be absorbed onto a unit of mass substrate<br />
: K<sub>iad</sub> &mdash; Dissociation constant for enzyme i<br />
: E<sub>iF</sub> &mdash; Free enzyme concentration for enzyme i<br />
: S &mdash; Substrate reactivity at a given time (g/kg)<br />
<br />
===Mass Balances===<br />
[[File:Edinburgh cellulose mass balance.png|thumb|center|700px| Cellulose mass balance ]]<br />
<br />
[[File:Edinburgh Cellobiose mass balance.png|thumb|center|700px| Cellobiose mass balance ]]<br />
<br />
[[File:Edinburgh glucose mass balance.png|thumb|center|700px| Glucose mass balance ]]<br />
<br />
===Arrhenius Equation===<br />
[[File:Edinburgh Arhennius mass balance.png|thumb|center|700px| Arrhenius equation is an <span class="hardword" id="empirical">empirical</span> relationship which is used to model the temperature dependent reaction rate constant. Note: T1 is set at 45 &deg;C ]]<br />
<br />
====Constants====<br />
<br />
: K<sub>ir</sub> &mdash; Reaction rate constant of reaction i<br />
: E<sub>ai</sub> &mdash; Activation energy of reaction i<br />
: R &mdash; Universal gas constant<br />
<br />
==Construction of Model==<br />
<br />
The model was constructed using the numerical programme MATLAB. A script file was generated which holds the variable dictionary, constants, temperature dependency equations, the "ODE45" differential equation solver, and the plot command. <br />
<br />
A separate function file to the script is created as script files can only operate on the variables that are coded into their m-files. R<sub>s</sub> (the substrate reactivity parameter) changes at every iteration because it is dependent on the S the substrate concentration at a given time, the substrate being cellulose. Therefore S at the first iteration is S<sub>0</sub>, the initial substrate concentration. At the second iteration S is the previous value calculated by the ODE, and so on. After each step the new value of S is fed into the function file and is used for calculating the reaction rate constant for cellobiose and glucose, etc. <br />
<br />
[[File:Edinburgh-Substrate_reactivity.png|thumb|center|700px| R<sub>s</sub> &mdash; substrate reactivity equation]]<br />
<br />
ODE45 calls on the function file to calculate the rate equations and then substitute them into the respective mass balance. A numerical integration is performed and the results can be seen below. ODE45 is used as it is more accurate than other solvers [http://www.mathworks.co.uk/help/techdoc/ref/ode23.html (according to Mathworks)]. It is based on an explicit <span class="hardword" id="rk">Runge-Kutta formula</span> and is a one-step solver.<br />
<br />
==Results==<br />
<br />
[[File:Edinburgh-Graph_1.png‎|thumb|center|700px| Figure 1: Graph of cellulose degradation over time with maximum &beta;-glucosidase.<br/> Initial conditions: Cellulose - 100 g/kg, Glucose - 0.01 g/kg , Cellobiose - 0.01 g/kg. <br/><br />
Enzymes: Exo/endo-glucanase - 0.01 g/kg, &beta;-glucosidase - 1 g/kg <br/> Temperature 35&deg; C]]<br />
<br />
<br/><br />
<br />
[[File:Edinburgh-Graph_2.png‎|thumb|center|700px| Figure 2: Graph of cellulose degradation over time with maximum Exo/endo-glucanase.<br/> Initial conditions: Cellulose - 100 g/kg, Glucose - 0.01 g/kg , Cellobiose - 0.01 g/kg. <br/><br />
Enzymes: Exo/endo-glucanase - 1 g/kg, &beta;-glucosidase - 0.01 g/kg <br/> Temperature 35&deg; C]]<br />
<br />
Figure 1 is set with &beta;-glucosidase at its maximum concentration and Figure 2 with Exo/endo-glucanase at maximum. This is to compare the effect of certain enzymes on cellulose degradation and glucose production. The result is consistent with what is expected. Exoglucanase chews away at the end of a cellulose chain, producing cellobiose sugars and endoglucanase cuts cellulose chanins in the centre, turning one chain into two. This concurs with the results, with Figure 1 modelling markedly higher amount of cellulose at the minimum amount of exo/endo-glucanase than that of Figure 2. Whereas &beta;-glucosidase cuts cellobiose in half, producing two glucose molecules. Figure 2 which &beta;-glucosidase is at its maximum produces 255.6% more glucose than in Figure 1 with &beta;-glucosidase at its minimum in 60 hours.<br />
<br />
The concentration of cellobiose in Figure 1 keeps low. This is because there is little cellulose converted to cellobiose by Exo/endo-glucanase. Also, if there is any cellobiose, they are all converted to glucose by &beta;-glucosidase. <br />
<br />
[[File:Edinburgh_semilogx3.png‎|thumb|center|700px| Figure 3: Graph of cellulose degradation over time with maximum &beta;-glucosidase.<br/> Initial conditions: Cellulose - 100 g/kg, Glucose - 0.01 g/kg , Cellobiose - 0.01 g/kg. <br/><br />
Enzymes: Exo/endo-glucanase - 1 g/kg, &beta;-glucosidase - 0.01 g/kg <br/> Temperature 35&deg; C. The x-axis is set to semilog.]]<br />
<br />
Figure 3 is under the same conditions as Figure 2, but its x-axis is set to a semilog scale to illustrate what happens over a longer period of time. The effect of high &beta;-glucosidase can better be seen with the complete conversion of cellobiose to glucose.<br />
<br />
(We'd like to thank the ETH Zurich team for fixing some problems with the simulation that led to this figure; where previously it violated the laws of physics, now it does not!)<br />
<br />
==Download MATLAB file==<br />
<br />
You can download the ready model as a .zip file:<br />
<br />
<html><center><a href="/File:Edinburgh_MATLAB_Cellulose_degradation.zip‎‎" class="nounderline"><img src="/wiki/images/5/59/Edinburgh-spinning-logo.gif" alt="Download the model file here"/></a></center></html><br />
<br />
==References== <br />
<br />
* Kadam KL, Rydholm EC, McMillan JD (2004) [http://onlinelibrary.wiley.com/doi/10.1021/bp034316x/full Development and Validation of a Kinetic Model for Enzymatic Saccharification of Lignocellulosic Biomass]. ''Biotechnology Progress'' '''20'''(3): 698–705 (doi: 10.1021/bp034316x).<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Model_ComparisonTeam:Edinburgh/Model Comparison2011-10-28T20:02:59Z<p>Allancrossman: /* Ability to reach steady state */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('model', 'model_comparison');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Model Comparison</p><br />
<br />
==The approaches ==<br />
<br />
*'''MATLAB''' - Within the reactor tasked with degrading cellulose into glucose in the biorefinery, temperature, enzyme concentration, substrate reactivity as well as xylose, cellobiose and glucose inhibition all govern the amount of glucose product. Deterministic modelling using a set of <span class="hardword" id="ode">ordinary differential equations</span> highlights the essential kinetic relationship among the enzymes, exo/endo-glucanase and &beta;-glucosidase. By solving these governing equations using the numerical tool MATLAB the level of degradation of cellulose is qualitatively predicted.<br />
<br />
*'''Kappa''' - As an alternative, <span class="hardword" id="stochastic">stochastic</span> models were created using the Kappa language. The system is defined in terms of many discrete agents and rules of their interaction. The Kappa simulator then uses probabilistic equations to simulate the evolution of the system, incorporating an indeterministic element into the system.<br />
<br />
*'''Spatial Kappa''' - Because of problems with the Kappa language, we decided to use a spatial extension developed by the [https://2010.igem.org/Team:Edinburgh Edinburgh 2010] iGEM team. This adds extra functionality to the language by introducing the concept of '''space'''.<br />
<br />
*'''C model''' - Intended more as a demonstration of synergy than an accurate model of the world, the cellulose is represented using a simple two-dimensional grid, on which enzymes move using <span class="hardword" id="brownian">Brownian motion</span>. This is an ''ad hoc'' model made in a general programming language. It was inspired by cellular-automata systems, though cannot really be considered one.<br />
<br />
==Comparison criteria==<br />
We chose the following criteria which are desirable in a model. They also show the main differences and similarities among our models, however the list is non-exhaustive.<br />
<br />
=== Flexibility ===<br />
<br />
We define flexibility as the capacity of a model to adopt different initial conditions. For example temperature, mass of substrate, strength of inhibition, and concentration of each enzyme.<br />
<br />
*'''Temperature'''<br />
** MATLAB - Very flexible as it incorporates the Arrhenius law which models the temperature-dependent reaction rate constant. You can input a temperature into an interactive prompt.<br />
** Spatial Kappa - Flexible. There is no empirical relationship incorporated in the model, however by changing diffusion rates between compartments one could (very imprecisely) simulate changes in temperature. There is a possibility that more precise results could be achieved using the Stokes-Einstein equation:<br/>[[File:Edinburgh-Stokes-Einstein.png|thumb|center|620px|T<sub>1</sub> and T<sub>2</sub> denote temperatures 1 and 2, respectively<br /><br />
D is the diffusion coefficient (cm<sup>2</sup>/s)<br /><br />
T is the absolute temperature (&deg;K),<br /><br />
μ is the dynamic viscosity of the solvent (Pa·s)<br /><br /><br />
(After [http://en.wikipedia.org/wiki/Mass_diffusivity#Temperature_dependence_of_the_diffusion_coefficient Wikipedia])]]<br />
** C - Temperature does not exist in the model. It would however be possible to extend it so that a temperature parameter influenced things like enzyme movement speed and probability to cut bonds.<br />
<br />
*'''Enzyme concentration'''<br />
** MATLAB - Can easily be changed by inputting a value (in the range of 0-1 g/kg for each enzyme) into an interactive prompt. The flexibility is beneficial especially when investigating optimum operating conditions in the biorefinery.<br />
** Kappa and Spatial Kappa - It is possible to change the number of enzyme agents by editing a separate file, which affects the ''relative'' concentration of enzymes (say, 3 times more of enzyme A than B). However, it would be non-trivial to translate that into an ''absolute'' value (e.g. 0.5 g of enzyme per 1kg of solution).<br />
** C - Similarly to Kappa, this can easily be changed in relative terms.<br />
<br />
*'''Strength of inhibition'''<br />
** MATLAB - Incorporates inhibition of enzymes based on glucose and cellobiose concentrations; the strength can be changed. There is also scope for xylose inhibition, but it is set to zero in this model.<br />
** Kappa and Spatial Kappa - The inhibition rates can be easily changed by editing a file with parameters.<br />
** C - Incorporates inhibition of exoglucanase by individual cellobiose molecules based on spatial location. Could be extended to include inhibition by glucose; and also to have free glucose taken out of the system after it is made.<br />
<br />
*'''Amount of raw material input'''<br />
** MATLAB - An interactive prompt asks the user for an initial amount of cellulose.<br />
** Kappa and Spatial Kappa - The initial amount of cellulose can be modified by editing a file. Also, in Spatial Kappa [[Team:Edinburgh/Cellulases_(Kappa_model)#Additional_cellulose | we ran experiments]] with adding more cellulose during the process.<br />
** C - The amount can be passed as a command-line argument.<br />
<br />
=== Computational cost ===<br />
<br />
The MATLAB, C and Kappa models do their work in relatively short periods of time.<br />
<br />
In contrast, the Spatial Kappa model takes a significant amount of time to run (about 30 minutes, depending on the settings of parameters). This is because when rules are translated from Spatial Kappa to the simulator, the complexity of the system increases. For a system with ''n'' compartments in ''d'' dimensions, one rule would need to be translated into ''n &times; d''&nbsp; rules, to take into account possible spatial locations of agents. That increases the time taken to run a simulation by a factor of ''n &times; d''. Fortunately, we had access to a computing cluster (ECDF, [http://www.ecdf.ed.ac.uk/ www.ecdf.ed.ac.uk]), where we could run 1,000 simulations in about 5 hours.<br />
<br />
=== Representing reality ===<br />
<br />
The MATLAB model is based on the <span class="hardword" id="empirical">empirical</span> literature, and so should be the best representation of reality. Units of substrate is grams per kilogram (g/kg) and time is in hours. The kinetic rates are based on experimental data which gives the model some validity, however only within certain time limits. <br />
<br />
However, since literature was not available for the synergistic system (with closely linked enzymes) we are considering, we had nothing to base a MATLAB model of synergy on. So, our only MATLAB model is the non-synergistic system.<br />
<br />
The C and Spatial Kappa models were capable of comparing a synergistic and a non-synergistic system, but in both cases the model is highly abstract and based only on our understanding of the system due to unavailability of empirical data for dynamics of cellulose, cellobiose and glucose.<br />
<br />
== Conclusions ==<br />
Although it is hard to compare the different approaches we took and even harder to choose and recommend the best one, our modelling gave us some important insights.<br />
<br />
To begin with, we successfully modelled synergy in C and Spatial Kappa, so these models tell us that '''synergy is a viable option'''. In case of MATLAB, there is still potential to improve the model to show synergy (by adding more ODEs), whereas it would be at least very cumbersome to do the same in plain Kappa.<br />
<br />
The '''MATLAB model should be the one most closely representing the real-world system'''. That is due to the fact that the model is built using experimentally adjusted values of constants and informed with known reaction equations. However, given sufficient data, it is '''also possible to adjust the Kappa / Spatial Kappa models''' to use different kinetic rates and concentrations of enzymes. It would require major modifications to achieve the same in the C model.<br />
<br />
The stochastic route taken by the C and (Spatial) Kappa models means that '''multiple simulations''' need to be run and averaged in order to get a robust estimate of cellulose dynamics. Whereas this takes a relatively short time for the '''C and Kappa models''', '''Spatial Kappa''' considerably increases the amount of time needed to do that.<br />
<br />
We would say that, as a general conclusion, '''all of our approaches have their strong points''' and are suited to different tasks - the stochastic approaches show us '''how''' our system works, whereas the deterministic approach gives us some '''real numbers''' against which to test the system.<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Cell_DisplayTeam:Edinburgh/Cell Display2011-10-28T20:01:39Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('home', 'home_cell');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Cell Surface Display: Proposals</p><br />
<br />
The first proposed system our feasibility study will examine, while searching for a way to keep extracellular enzymes close together, is based on displaying proteins at high density on an <span class="hardword" id="ec">''E. coli''</span> outer membrane. This type of display is called "cell surface display".<br />
<br />
We will attempt to design such a system for <span class="hardword" id="cellulase">cellulases</span>, and see if we can get it to work.<br />
<br />
==Outline==<br />
<br />
In order to get a normal enzyme displayed on the ''E. coli'' outer membrane, the enzyme must be fused to a carrier protein; that is, one which is naturally transported to the outer membrane.<br />
<br />
[https://2009.igem.org/Team:Berkeley_Wetlab/Assay_Protocols Berkeley 2009] tried several different carrier proteins with several different passenger enzymes, and had success in many areas. However, when they tried attaching cellulases, they [https://2009.igem.org/Team:Berkeley_Wetlab/Passenger:_Cellulases weren't so successful] - of the two quantified cellulases, one worked just as well without the carrier (Cel5b) and the other didn't work (Cel9a, as compared to negative control).<br />
<br />
We will try a different carrier. The <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K265008 BBa_K265008] made by [https://2009.igem.org/Team:UC_Davis UC Davis 2009] is a synthetic, codon-optimised sequence, based on [http://www.ncbi.nlm.nih.gov/nuccore/AF013159 GenBank AF013159] and coding for the first 211 and last 97 amino acids of <span class="hardword" id="inp">Ice Nucleation Protein</span> (INP, normally coded by the ''inaK'' gene) from the bacterium <span class="hardword" id="ps">Pseudomonas syringae</span>. It seems promising as a carrier of enzymes. Fusions are carried out at the INP C terminal.<br />
<br />
[[File:Three-displays.png|thumb|center|600px|Three strategies for INP-based cell display. After [http://www.sciencedirect.com/science/article/pii/S016777991000199X Van Bloois ''et al'' (2011)]]]<br />
<br />
[http://www.sciencedirect.com/science/article/pii/S016777991000199X Van Bloois ''et al'' (2011)] speak highly of INP, and claim that it can be displayed at a copy number of around 100,000 copies per cell without affecting viability.<br />
<br />
INP has major domains at its N and C terminals, as well as a number of internal repeating domains. There seem to be three strategies for using INP (see figure):<br />
<br />
* Use the entire INP protein; fuse at its C terminal<br />
* Delete the INP internal domains; fuse at its C terminal<br />
* Delete all of INP except the N domain; fuse at the new C terminal<br />
<br />
[http://partsregistry.org/Part:BBa_K265008 BBa_K265008] should be suitable for the 2nd strategy.<br />
<br />
===Linkers===<br />
<br />
It is probably desirable to create <span class="hardword" id="linker">linkers</span> between the carrier and the protein of interest, to give the proteins space to fold. The new assembly protocol that we are investigating &mdash; [[Team:Edinburgh/BioSandwich|BioSandwich]] &mdash; should be ideal for this.<br />
<br />
===Complete system===<br />
<br />
The complete 3 cellulase system could contain a promoter, driving expression of three coding fusions:<br />
<br />
* INP -- (Linker) -- endoglucanase (e.g. [http://partsregistry.org/Part:BBa_K392006 BBa_K392006])<br />
* INP -- (Linker) -- exoglucanase (e.g. [http://partsregistry.org/Part:BBa_K392007 BBa_K392007])<br />
* INP -- (Linker) -- &beta;-glucosidase (e.g. [http://partsregistry.org/Part:BBa_K392008 BBa_K392008])<br />
<br />
===An alternative: protein chains===<br />
<br />
[[File:INP-chain.png|thumb|center|600px|The protein chain idea: a long fusion protein is created with INP fused to (say) 3 enzymes in a row...]]<br />
<br />
Instead of making three different fusions, it might be possible to make one fusion that had all three cellulase enzymes linked together; we call this "beads on a string". As it happens, the exoglucanase (Cex) and the endoglucanase (CenA) both have a cellulose-binding module (CBM), but they are at different ends of the sequence. So here's the plan:<br />
<br />
* Create a fusion of:<br />
** '''Exoglucanase''' (catalytic domain) -- '''CBM''' -- '''Endoglucanase''' (catalytic domain)<br />
** This can be done by homology or by introducing an NcoI site into both Exo- and Endoglucanase at the appropriate locations, then ligating and doing fusion PCR.<br />
* We can then use KpnI in a similar way to attach a '''&beta;-glucosidase''' at either end.<br />
* Then attach INP.<br />
<br />
==Genetic instability==<br />
<br />
In order to display several different proteins on one bacterium using the first strategy, it will be necessary to have several copies of the INP gene fused to different enzymes. The presence of repeated sequences on a plasmid can lead to genetic instability.<br />
<br />
This will not be a problem in the JM109 lab strain, which lacks an important <span class="hardword" id="recombination">recombination</span> enzyme. As for the use of this technology in industry, it will be possible to overcome this problem simply by synthesising coding sequences with as many altered (but <span class="hardword" id="synonymouscodon">synonymous</span>) codons as possible. We have written a software tool for designing such sequences... see the [[Team:Edinburgh/Genetic instability|genetic instability]] page.<br />
<br />
==Proof of concept: YFP==<br />
<br />
As far as we know, nobody has used [http://partsregistry.org/Part:BBa_K265008 BBa_K265008] for cell display. We could prove that it works by simply displaying the Yellow Fluorescent Protein on INP. Indeed, something similar was achieved by [http://www.postech.edu/~hjcha/INP-N-GFP-OPH.pdf Li ''et al'' (2004)] and [http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.2009.01724.x/abstract Li ''et al'' (2009)] for a different version of the gene.<br />
<br />
==Results==<br />
<br />
Please see the team's [[Team:Edinburgh/Data | Data Page]] for information about how far we got with this project.<br />
<br />
==References==<br />
<br />
* Li L, Kang DG, Cha HJ (2004) [http://www.postech.edu/~hjcha/INP-N-GFP-OPH.pdf Functional display of foreign protein on surface of ''Escherichia coli'' using N-terminal domain of Ice Nucleation Protein]. ''Biotechnology and Bioengineering'' '''85'''(2): 214-221 (doi: 10.1002/bit.10892).<br />
<br />
* Li Q, Yu Z, Shao X, He J, Li L (2009) [http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.2009.01724.x/abstract Improved phosphate biosorption by bacterial surface display of phosphate-binding protein utilizing ice nucleation protein]. ''FEMS Microbiology Letters'' '''299'''(1): 44-52 (doi: 10.1111/j.1574-6968.2009.01724.x).<br />
<br />
* Van Bloois E, Winter RT, Kolmar H, Fraaije MW (2011) [http://www.sciencedirect.com/science/article/pii/S016777991000199X Decorating microbes: surface display of proteins on ''Escherichia coli'']. ''Trends in Biotechnology'' '''29'''(2): 79-86 (doi: 10.1016/j.tibtech.2010.11.003).<br />
<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-28T19:59:00Z<p>Allancrossman: /* cxnA */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of <span class="hardoword" id="cellobiose">cellobiose</span>.<br />
<br />
We tested the ability of ''E. coli'' with this ''bglX'' part to grow on minimal media with cellobiose as the only carbon source. It could not. By contrast, it did grow if glucose was the carbon source, showing that it is fundamentally capable of growing on minimal media:<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:K523014 on cellobiose.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:K523014 glucose control.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|Cellobiose as the only carbon source. K523014 (bottom) fails to grow.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|Glucose as the only carbon source. K523014 can grow.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==''cxnA''==<br />
<br />
In line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal, We created a fusion of ''cex'' and ''cenA''. This showed the activity of both enzymes:<br />
<br />
* Cex activity was tested on MUC plates.<br />
* CenA activity was tested on carboxymethylcellulose (CMC) plates.<br />
<br />
The latter test produces a zone of clearing if CMC is degraded by the endoglucanase domain. We had three successful colonies:<br />
<br />
<br />
[[File:K523025_on_congo_red.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523025 BBa_K523025].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/User:AllancrossmanUser:Allancrossman2011-10-28T18:38:15Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_foo');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Allan Crossman</p><br />
<br />
Allan Crossman, member of [[Team:Edinburgh|Edinburgh 2011]].<br />
<br />
==Notes to self==<br />
<br />
* [[Judging]]<br />
* [https://igem.org/Results?year=2011 2011 full results]<br />
* [http://mic.sgmjournals.org/content/142/7/1659.full.pdf+html bglX info]<br />
* [[User:Allancrossman/Gibson]] and [[User:Allancrossman/Gibson2]]<br />
* [http://www.ncbi.nlm.nih.gov/nuccore/AF130864.1 pG8SAET]<br />
* [[Special:Watchlist]]<br />
<br />
==Stuff others are doing==<br />
<br />
* [https://2011.igem.org/Special:Contributions/Yazbo91 Contributions: Yassen]<br />
* [https://2011.igem.org/Special:Contributions/L.Kopec Contributions: Lukasz]<br />
* [https://2011.igem.org/Special:Contributions/mclee Contributions: Lee]<br />
* [https://2011.igem.org/Special:Contributions/sylvia.ispasani Contributions: Sylvia]<br />
* [https://2011.igem.org/Special:Contributions/Fionntom Contributions: Fionn]<br />
* [https://2011.igem.org/Special:Contributions/Di.L Contributions: Di]<br />
<br />
==Competitors in our track==<br />
<br />
: '''Progress to MIT:'''<br />
:: [[Team:Edinburgh]] (gold)<br />
:: [[Team:Johns_Hopkins]] (bronze)<br />
:: [[Team:UTP-Panama]] (bronze)<br />
:: [[Team:Washington]] (gold, Americas overall winner)<br />
:: [[Team:Yale]] (gold, Americas finalist)<br />
<br />
: '''Did not progress:'''<br />
:: [[Team:Alberta]]<br />
:: [[Team:Debrecen_Hungary]]<br />
:: [[Team:HIT-Harbin]]<br />
:: [[Team:Korea_U_Seoul]]<br />
:: [[Team:Nevada]]<br />
:: [[Team:Tec-Monterrey]]<br />
:: [[Team:Tianjin]]<br />
:: [[Team:UNAM-Genomics_Mexico]]<br />
:: [[Team:UST-Beijing]]<br />
:: [[Team:WashU]]<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/DataTeam:Edinburgh/Data2011-10-28T18:35:29Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab','lab_data');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Data Overview</p> <!-- see https://igem.org/Sample_Data_Page for example page. --><br />
<br />
This page provides an overview of the purely biological aspects of our feasibility study, and links to the relevant Parts Registry pages.<br />
<br />
==Cell Surface Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Cell Display | Cell Surface Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them at high copy number on the cell's outer membrane. <span class="hardword" id="inp">Ice Nucleation Protein</span> is used as a carrier for display of the enzymes; it carries them to the outer membrane.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Cell-Display.png|thumb|center|600px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''INP&mdash;Endoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523011 BBa_K523011])<br><br />
&nbsp; &nbsp; an '''INP&mdash;&beta;-glucosidase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523004 BBa_K523004])<br><br />
&nbsp; &nbsp; an '''INP&mdash;Exoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523009 BBa_K523009])<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals.<br><br><br />
Cellulose degradation is shown at the bottom. In reality, tens of thousands of enzymes will cover the outer membrane in random places.<br><br>A test system to prove that [http://partsregistry.org/Part:BBa_K523008 BBa_K523008] can be used to carry proteins to the outer membrane uses a fusion of INP to '''Yellow Fluorescent Protein (YFP)''' instead.]]<br />
<br />
===Cell surface display Animation===<br />
<br />
<html> <br />
<br />
<body> <br />
<br />
<object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" <br />
<br />
codebase="http://download.macromedia.com/pub/shockwave/<br />
cabs/flash/swflash.cab#version=6,0,40,0" <br />
<br />
width="468" height="60" <br />
id="INP"> <br />
<br />
<param name="movie" value="https://static.igem.org/mediawiki/2011/d/da/INP_Web.swf" /> <br />
<br />
<param name="quality" value="high" /> <br />
<br />
<embed src="https://static.igem.org/mediawiki/2011/d/da/INP_Web.swf" quality="high" width="725" height="310" <br />
<br />
name="INP" align="" type="application/x-shockwave-flash" <br />
<br />
pluginspage="http://www.macromedia.com/go/getflashplayer"> <br />
<br />
</embed> <br />
</object> <br />
</body><br />
<p><strong><a href="https://static.igem.org/mediawiki/2011/d/da/INP_Web.swf" target="_blank">Click here to view the animation in full screen mode.</a></strong></p><br />
<br />
</html> <br />
<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Shown that INP ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008], based on [http://partsregistry.org/Part:BBa_K265008 BBa_K265008]) can be used to carry proteins to the cell membrane, by constructing [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
* Made and tested a new &beta;-glucosidase ''(bglX)'' BioBrick, [http://partsregistry.org/Part:BBa_K523002 BBa_K523002].<br />
* Made ''bglX'' into a format compatible with our BioSandwich assembly protocol ([http://partsregistry.org/Part:BBa_K523004 BBa_K523004]).<br />
* Made new versions of other cellulases, in a format compatible with the BioSandwich protocol.<br />
* Tested an old exoglucanase gene, [http://partsregistry.org/Part:BBa_K118022 BBa_K118022].<br />
* Made fusions of INP to ''bglX'' (&beta;-glucosidase) and ''cex'' (exoglucanase).<br />
* Made a fusion of ''cex'' to ''cenA'' ([http://partsregistry.org/Part:BBa_K523025 BBa_K523025]) and shown that it works.<br />
<br />
==Phage Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Phage Display | Phage Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them on an <span class="hardword" id="m13">M13</span> <span class="hardword" id="phage">phage</span>. The major coat protein <span class="hardword" id="p8">pVIII</span> is used as a carrier for display of the enzymes; it incorporates them into the phage.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Phage-Display.png|thumb|center|600px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''Endoglucanase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; a '''&beta;-glucosidase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; an '''Exoglucanase&mdash;pVIII''' fusion<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals. '''"Signal"''' means a periplasmic signal sequence, directing the protein to the periplasm to be assembled into the phage.<br><br>A test system uses a fusion of pVIII to ''E. coli'' amylase '''MalS''' instead.]]<br />
<br />
===Phage display Animation===<br />
<html> <br />
<br />
<body> <br />
<br />
<object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" <br />
<br />
codebase="http://download.macromedia.com/pub/shockwave/<br />
cabs/flash/swflash.cab#version=6,0,40,0" <br />
<br />
width="468" height="60" <br />
id="PHAGE"> <br />
<br />
<param name="movie" <br />
<br />
value=https://static.igem.org/mediawiki/2011/0/0b/Phage_Web.swf /> <br />
<br />
<param name="quality" value="high" /> <br />
<br />
<param name="bgcolor" value="#ffffff" /> <br />
<br />
<embed src="https://static.igem.org/mediawiki/2011/0/0b/Phage_Web.swf" quality="high" bgcolor="#ffffff"<br />
<br />
width="725" height="390" <br />
<br />
name="PHAGE" align="" type="application/x-shockwave-flash" <br />
<br />
pluginspage="http://www.macromedia.com/go/getflashplayer"> <br />
<br />
<br />
</embed> <br />
<br />
</object> <br />
<br />
</body><br />
<br />
<p><strong><a href="https://static.igem.org/mediawiki/2011/0/0b/Phage_Web.swf" target="_blank">Click here to view the animation in full screen mode.</a></strong></p><br />
</html> <br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Made and tested a new amylase ''(malS)'' BioBrick, [http://partsregistry.org/Part:BBa_K523001 BBa_K523001].<br />
* Attempted to fuse it to the major coat protein pVIII.<br />
<br />
==BioSandwich==<br />
<br />
[[Team:Edinburgh/BioSandwich | BioSandwich]] ([[:File:RFC81.pdf|RFC 81]]) is a new assembly protocol that we used.<br />
<br />
Parts made using BioSandwich that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
==Favourite BioBricks==<br />
<br />
(A complete list of parts made during the project is found at the dedicated [[Team:Edinburgh/Parts | Parts]] page.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523000 BBa_K523000]: Plac + lacZ; with BglII site'''<br />
: Intended as a cloning vector (when present in pSB1C3), this part allows Blue/White selection of newly PCR'ed BioBricks. The PCR primers required are shorter than would be required using the standard method. It encodes LacZ&alpha;; new BioBricks that have successfully replaced the part will be white on plates containing IPTG and Xgal. Parts created in this way will also be compatible with the BioSandwich assembly protocol. We proved this part worked by using it to create several other BioBricks.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523006 BBa_K523006]: Plac + malS'''<br />
: ''malS'' is a <span class="hardword" id="periplasm">periplasmic</span> ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found evidence of <span class="hardword" id="starch">starch</span> degrading activity.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: Plac + INP-EYFP'''<br />
: A fusion of Ice Nucleation Protein and Enhanced Yellow Fluorescent Protein under the control of the Lac promoter. Fluoresces yellow under blue light. May be localised to the outer membrane.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523014 BBa_K523014]: Plac + bglX'''<br />
: ''bglX'' is a <span class="hardword" id="cryptic">cryptic</span> &beta;-glucosidase gene from ''E. coli''. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found it to be capable of degrading the <span class="hardword" id="cellobiose">cellobiose</span> analog, MUG.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523025 BBa_K523025]: Plac + cxnA'''<br />
: ''cxnA'' is a fusion we constructed (in line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal), containing an exoglucanase and an endoglucanse; it was found to have the functions of both enzymes.<br />
<br />
==Other BioBricks analysed==<br />
<br />
(More details of this are found at the dedicated [[Team:Edinburgh/Collaboration | Collaboration]] page. The information has also been added to the parts' "Experience" sections.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K118022:Experience BBa_K118022]: ''C. fimi'' exoglucanase'''<br />
: At the same time as we tested ''bglX'' for activity, we also tested this old part's ability to degrade the cellobiose analog MUG (weak ability) and the cellulose analog MUC (strong ability).<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K415151:Experience BBa_K415151]: p8-GR1'''<br />
: Supposed to encode a fusion of the pVIII protein to a GR1 zipper. It actually encodes part of the ''E. coli'' aminopeptidase N gene.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K392008:Experience BBa_K392008]: ''C. fimi'' &beta;-glucosidase'''<br />
: We discovered that this part almost certainly starts its coding sequence at the second ATG present, not the first. This is highly relevant information for anyone trying to tune its expression via use of custom Ribosome Binding Sites.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K265008:Experience BBa_K265008]: Ice Nucleation Protein'''<br />
: We successfully used this part, fusing it to Enhanced Yellow Fluorescent Protein, which was apparently transported to the outer membrane as a result.<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-28T18:30:54Z<p>Allancrossman: /* cxnA */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of <span class="hardoword" id="cellobiose">cellobiose</span>.<br />
<br />
We tested the ability of ''E. coli'' with this ''bglX'' part to grow on minimal media with cellobiose as the only carbon source. It could not. By contrast, it did grow if glucose was the carbon source, showing that it is fundamentally capable of growing on minimal media:<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:K523014 on cellobiose.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:K523014 glucose control.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|Cellobiose as the only carbon source. K523014 (bottom) fails to grow.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|Glucose as the only carbon source. K523014 can grow.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==''cxnA''==<br />
<br />
In line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal, We created a fusion of ''cex'' and ''cenA''. This showed the activity of both enzymes:<br />
<br />
* Cex activity was tested on MUC plates.<br />
* CenA activity was tested on carboxymethylcellulose (CMC) plates.<br />
<br />
The latter test produces a zone of clearing if CMC is degraded by endoglucanase. We had three successful colonies:<br />
<br />
<br />
[[File:K523025_on_congo_red.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523025 BBa_K523025].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-28T18:30:37Z<p>Allancrossman: /* cxnA */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of <span class="hardoword" id="cellobiose">cellobiose</span>.<br />
<br />
We tested the ability of ''E. coli'' with this ''bglX'' part to grow on minimal media with cellobiose as the only carbon source. It could not. By contrast, it did grow if glucose was the carbon source, showing that it is fundamentally capable of growing on minimal media:<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:K523014 on cellobiose.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:K523014 glucose control.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|Cellobiose as the only carbon source. K523014 (bottom) fails to grow.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|Glucose as the only carbon source. K523014 can grow.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==''cxnA''==<br />
<br />
In line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal, We created a fusion of ''cex'' and ''cenA''. This showed the activity of both enzymes:<br />
<br />
* Cex activity was tested on MUC plates.<br />
* CenA activity was tested on carboxymethylcellulose (CMC) plates.<br />
<br />
The latter test produces a zone of clearing if CMC is degraded by endoglucanase. We had three successful colonies:<br />
<br />
[[File:K523025_on_congo_red.jpg|400px|center]]<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523025 BBa_K523025].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/File:K523025_on_congo_red.jpgFile:K523025 on congo red.jpg2011-10-28T18:30:18Z<p>Allancrossman: </p>
<hr />
<div></div>Allancrossmanhttp://2011.igem.org/User_talk:Yazbo91User talk:Yazbo912011-10-28T17:55:19Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_foo');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Yassen's talk page</p><br />
<br />
Oh hai.<br />
<br />
Some comments:<br />
<br />
* When you define steady state as meaning 99% of the cellulose is used up, it becomes unclear what it means for cellobiose or glucose.<br />
* You say Figure 3 shows cellobiose doesn't reach a steady state. But it goes to zero. If you mean it goes negative, you'll have to replot the graph to show that...<br />
* You say "Analysing steady state is important to find out whether a system accumulates excess mass or energy" - but we know it can't in reality, right, since this violates physics? Do you mean analysing steady state is important as a way of testing if the model is sane?<br />
<br />
<br />
[[User:Allancrossman|Allancrossman]] 16:38, 9 September 2011 (CDT)<br />
<br />
==Tables==<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment<br />
!Size (m<sup>3</sup>)<br />
!Cost constant (&pound;)<br />
!Index<br />
!Purchase cost (&pound;)<br />
!Number required<br />
!Total cost (&pound;)<br />
|-<br />
|Boiler<br />
|8<br />
|70<br />
|0.8<br />
|13,218.33<br />
|4<br />
|52,873.31<br />
|-<br />
|Reactor 1<br />
|4<br />
|18,5000<br />
|0.45<br />
|47,158.74<br />
|1<br />
|47,158.74<br />
|-<br />
|Reactor 2<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 3<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 4<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 5<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 6<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Tank 100-102<br />
|3.3<br />
|1,400<br />
|0.55<br />
|2,699.67<br />
|3<br />
|8099.01<br />
|-<br />
|Tank 103<br />
|93.2<br />
|1,400<br />
|0.55<br />
|16,955.35<br />
|1<br />
|16,955.35<br />
|-<br />
|Tank 104<br />
|40<br />
|1,400<br />
|0.55<br />
|10,647.83<br />
|1<br />
|10,647.83<br />
|-<br />
|Tank 105<br />
|147<br />
|1,400<br />
|0.55<br />
|21,784.75<br />
|1<br />
|21,784.75<br />
|-<br />
|Tank 106<br />
|17<br />
|1,400<br />
|0.55<br />
|6,650.82<br />
|1<br />
|6,650.82<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Factorial number<br />
!Item<br />
!Factor<br />
|-<br />
|f1<br />
|Equipment erection<br />
|0.45<br />
|-<br />
|f2<br />
|Piping<br />
|0.45<br />
|-<br />
|f3<br />
|Instrumentation<br />
|0.15<br />
|-<br />
|f4<br />
|Electrical<br />
|0.1<br />
|-<br />
|f5<br />
|Buildings, process<br />
|0.1<br />
|-<br />
|f6<br />
|Ancillary buildings<br />
|0.2<br />
|-<br />
|colspan="2"|<br />
|'''Total = 1.45'''<br />
|-<br />
|f10<br />
|Design and Engineering<br />
|0.25<br />
|-<br />
|f11<br />
|Contractor’s Fee<br />
|0.05<br />
|-<br />
|f12<br />
|Contingency<br />
|0.1<br />
|-<br />
|colspan="2"|<br />
|'''Total = 0.4'''<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Type<br />
!Amount<br />
!Unit price<br />
!Cost<br />
|-<br />
|Steam<br />
|200 kg/h<br />
|&pound;7/t<br />
|&pound;9811.2<br />
|-<br />
|Cooling water<br />
|3,000 kg/h<br />
|1.5p/t<br />
|&pound;315.36<br />
|-<br />
|Power<br />
|100 kWh/d<br />
|1.2p/mj<br />
|&pound;43,200<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment number<br />
!Equipment name<br />
!Comment<br />
|-<br />
|Tank 100,101,102<br />
|Feed storage tanks<br />
|Capacity: 3.3 m<sup>3</sup><br />
|-<br />
|Tank 103<br />
|Product storage tank<br />
|Capacity: 93.2 m<sup>3</sup><br />
|-<br />
|Tank 104<br />
|Product storage tank<br />
|Capacity: 40 m<sup>3</sup><br />
|-<br />
|Tank 105<br />
|Product storage tank<br />
|Capacity: 147 m<sup>3</sup><br />
|-<br />
|Tank 106<br />
|Product storage tank<br />
|Capacity: 17 m<sup>3</sup><br />
|-<br />
|colspan="3"|&nbsp;<br />
|-<br />
|R-1<br />
|Pre-treatment reactor<br />
|Capacity:8 m<sup>3</sup>, 140 C, 20 bar<br />
|-<br />
|R-2<br />
|Thermal depolymerisation of hemicellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-3<br />
|Hydrous pyrolysis of lignin<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-4<br />
|Degradation of cellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-5<br />
|Conversion of glucose to sorbitol<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-6<br />
|Conversion of glucose to fructose syrup<br />
|Capacity 4 m<sup>3</sup><br />
|-<br />
|P-1, P-2<br />
|Pumps<br />
|<br />
|-<br />
|D-1<br />
|Recovery column <br />
|1 bar<br />
|-<br />
|HE-1, 2, 3, 4<br />
|Heat exchangers<br />
|<br />
|-<br />
|LI-1, 2, 3, 4, 5, 6, 7, 8, 9<br />
|Level indicators<br />
|PID control<br />
|-<br />
|TI-1, 2, 3, 4, 5, 6<br />
|Temperature indicators<br />
|PID control<br />
|-<br />
|FI-1 to FI-15<br />
|Flow indicators<br />
|PID control<br />
|-<br />
|V-1, 2, 3, 6, 7, 8<br />
|Mixing valve<br />
|<br />
|-<br />
|V-4, 5<br />
|Angle valve<br />
|<br />
|-<br />
|V-9 to V-42<br />
|Gate valve<br />
|<br />
|}<br />
<br />
<br />
End of tables.<br />
<br />
----<br />
<br />
I moved that to [[Team:Edinburgh/Phage_Display]] though it looks terrible on a smallish screen. And too much whitespace on left and right edges... [[User:Allancrossman|Allancrossman]] 12:22, 28 October 2011 (CDT)<br />
<br />
Oops I meant [[Team:Edinburgh/Cell_Display]]. [[User:Allancrossman|Allancrossman]] 12:34, 28 October 2011 (CDT)<br />
<br />
----<br />
<br />
Because aside from looking bad on a smallish screen, it would logically fit better there. On the data page it's a bit redundant. Besides, the data page is supposed to [https://igem.org/Sample_Data_Page follow roughly this format]. [[User:Allancrossman|Allancrossman]] 12:55, 28 October 2011 (CDT)<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/User_talk:Yazbo91User talk:Yazbo912011-10-28T17:34:30Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_foo');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Yassen's talk page</p><br />
<br />
Oh hai.<br />
<br />
Some comments:<br />
<br />
* When you define steady state as meaning 99% of the cellulose is used up, it becomes unclear what it means for cellobiose or glucose.<br />
* You say Figure 3 shows cellobiose doesn't reach a steady state. But it goes to zero. If you mean it goes negative, you'll have to replot the graph to show that...<br />
* You say "Analysing steady state is important to find out whether a system accumulates excess mass or energy" - but we know it can't in reality, right, since this violates physics? Do you mean analysing steady state is important as a way of testing if the model is sane?<br />
<br />
<br />
[[User:Allancrossman|Allancrossman]] 16:38, 9 September 2011 (CDT)<br />
<br />
==Tables==<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment<br />
!Size (m<sup>3</sup>)<br />
!Cost constant (&pound;)<br />
!Index<br />
!Purchase cost (&pound;)<br />
!Number required<br />
!Total cost (&pound;)<br />
|-<br />
|Boiler<br />
|8<br />
|70<br />
|0.8<br />
|13,218.33<br />
|4<br />
|52,873.31<br />
|-<br />
|Reactor 1<br />
|4<br />
|18,5000<br />
|0.45<br />
|47,158.74<br />
|1<br />
|47,158.74<br />
|-<br />
|Reactor 2<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 3<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 4<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 5<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 6<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Tank 100-102<br />
|3.3<br />
|1,400<br />
|0.55<br />
|2,699.67<br />
|3<br />
|8099.01<br />
|-<br />
|Tank 103<br />
|93.2<br />
|1,400<br />
|0.55<br />
|16,955.35<br />
|1<br />
|16,955.35<br />
|-<br />
|Tank 104<br />
|40<br />
|1,400<br />
|0.55<br />
|10,647.83<br />
|1<br />
|10,647.83<br />
|-<br />
|Tank 105<br />
|147<br />
|1,400<br />
|0.55<br />
|21,784.75<br />
|1<br />
|21,784.75<br />
|-<br />
|Tank 106<br />
|17<br />
|1,400<br />
|0.55<br />
|6,650.82<br />
|1<br />
|6,650.82<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Factorial number<br />
!Item<br />
!Factor<br />
|-<br />
|f1<br />
|Equipment erection<br />
|0.45<br />
|-<br />
|f2<br />
|Piping<br />
|0.45<br />
|-<br />
|f3<br />
|Instrumentation<br />
|0.15<br />
|-<br />
|f4<br />
|Electrical<br />
|0.1<br />
|-<br />
|f5<br />
|Buildings, process<br />
|0.1<br />
|-<br />
|f6<br />
|Ancillary buildings<br />
|0.2<br />
|-<br />
|colspan="2"|<br />
|'''Total = 1.45'''<br />
|-<br />
|f10<br />
|Design and Engineering<br />
|0.25<br />
|-<br />
|f11<br />
|Contractor’s Fee<br />
|0.05<br />
|-<br />
|f12<br />
|Contingency<br />
|0.1<br />
|-<br />
|colspan="2"|<br />
|'''Total = 0.4'''<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Type<br />
!Amount<br />
!Unit price<br />
!Cost<br />
|-<br />
|Steam<br />
|200 kg/h<br />
|&pound;7/t<br />
|&pound;9811.2<br />
|-<br />
|Cooling water<br />
|3,000 kg/h<br />
|1.5p/t<br />
|&pound;315.36<br />
|-<br />
|Power<br />
|100 kWh/d<br />
|1.2p/mj<br />
|&pound;43,200<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment number<br />
!Equipment name<br />
!Comment<br />
|-<br />
|Tank 100,101,102<br />
|Feed storage tanks<br />
|Capacity: 3.3 m<sup>3</sup><br />
|-<br />
|Tank 103<br />
|Product storage tank<br />
|Capacity: 93.2 m<sup>3</sup><br />
|-<br />
|Tank 104<br />
|Product storage tank<br />
|Capacity: 40 m<sup>3</sup><br />
|-<br />
|Tank 105<br />
|Product storage tank<br />
|Capacity: 147 m<sup>3</sup><br />
|-<br />
|Tank 106<br />
|Product storage tank<br />
|Capacity: 17 m<sup>3</sup><br />
|-<br />
|colspan="3"|&nbsp;<br />
|-<br />
|R-1<br />
|Pre-treatment reactor<br />
|Capacity:8 m<sup>3</sup>, 140 C, 20 bar<br />
|-<br />
|R-2<br />
|Thermal depolymerisation of hemicellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-3<br />
|Hydrous pyrolysis of lignin<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-4<br />
|Degradation of cellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-5<br />
|Conversion of glucose to sorbitol<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-6<br />
|Conversion of glucose to fructose syrup<br />
|Capacity 4 m<sup>3</sup><br />
|-<br />
|P-1, P-2<br />
|Pumps<br />
|<br />
|-<br />
|D-1<br />
|Recovery column <br />
|1 bar<br />
|-<br />
|HE-1, 2, 3, 4<br />
|Heat exchangers<br />
|<br />
|-<br />
|LI-1, 2, 3, 4, 5, 6, 7, 8, 9<br />
|Level indicators<br />
|PID control<br />
|-<br />
|TI-1, 2, 3, 4, 5, 6<br />
|Temperature indicators<br />
|PID control<br />
|-<br />
|FI-1 to FI-15<br />
|Flow indicators<br />
|PID control<br />
|-<br />
|V-1, 2, 3, 6, 7, 8<br />
|Mixing valve<br />
|<br />
|-<br />
|V-4, 5<br />
|Angle valve<br />
|<br />
|-<br />
|V-9 to V-42<br />
|Gate valve<br />
|<br />
|}<br />
<br />
<br />
End of tables.<br />
<br />
----<br />
<br />
I moved that to [[Team:Edinburgh/Phage_Display]] though it looks terrible on a smallish screen. And too much whitespace on left and right edges... [[User:Allancrossman|Allancrossman]] 12:22, 28 October 2011 (CDT)<br />
<br />
Oops I meant [[Team:Edinburgh/Cell_Display]]. [[User:Allancrossman|Allancrossman]] 12:34, 28 October 2011 (CDT)<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Cell_DisplayTeam:Edinburgh/Cell Display2011-10-28T17:33:50Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('home', 'home_cell');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Cell Surface Display: Proposals</p><br />
<br />
The first proposed system our feasibility study will examine, while searching for a way to keep extracellular enzymes close together, is based on displaying proteins at high density on an <span class="hardword" id="ec">''E. coli''</span> outer membrane. This type of display is called "cell surface display".<br />
<br />
We will attempt to design such a system for <span class="hardword" id="cellulase">cellulases</span>, and see if we can get it to work.<br />
<br />
==Outline==<br />
<br />
In order to get a normal enzyme displayed on the ''E. coli'' outer membrane, the enzyme must be fused to a carrier protein; that is, one which is naturally transported to the outer membrane.<br />
<br />
[https://2009.igem.org/Team:Berkeley_Wetlab/Assay_Protocols Berkeley 2009] tried several different carrier proteins with several different passenger enzymes, and had success in many areas. However, when they tried attaching cellulases, they [https://2009.igem.org/Team:Berkeley_Wetlab/Passenger:_Cellulases weren't so successful] - of the two quantified cellulases, one worked just as well without the carrier (Cel5b) and the other didn't work (Cel9a, as compared to negative control).<br />
<br />
We will try a different carrier. The <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K265008 BBa_K265008] made by [https://2009.igem.org/Team:UC_Davis UC Davis 2009] is a synthetic, codon-optimised sequence, based on [http://www.ncbi.nlm.nih.gov/nuccore/AF013159 GenBank AF013159] and coding for the first 211 and last 97 amino acids of <span class="hardword" id="inp">Ice Nucleation Protein</span> (INP, normally coded by the ''inaK'' gene) from the bacterium <span class="hardword" id="ps">Pseudomonas syringae</span>. It seems promising as a carrier of enzymes. Fusions are carried out at the INP C terminal.<br />
<br />
[[File:Three-displays.png|thumb|center|600px|Three strategies for INP-based cell display. After [http://www.sciencedirect.com/science/article/pii/S016777991000199X Van Bloois ''et al'' (2011)]]]<br />
<br />
[http://www.sciencedirect.com/science/article/pii/S016777991000199X Van Bloois ''et al'' (2011)] speak highly of INP, and claim that it can be displayed at a copy number of around 100,000 copies per cell without affecting viability.<br />
<br />
INP has major domains at its N and C terminals, as well as a number of internal repeating domains. There seem to be three strategies for using INP (see figure):<br />
<br />
* Use the entire INP protein; fuse at its C terminal<br />
* Delete the INP internal domains; fuse at its C terminal<br />
* Delete all of INP except the N domain; fuse at the new C terminal<br />
<br />
[http://partsregistry.org/Part:BBa_K265008 BBa_K265008] should be suitable for the 2nd strategy.<br />
<br />
===Linkers===<br />
<br />
It is probably desirable to create <span class="hardword" id="linker">linkers</span> between the carrier and the protein of interest, to give the proteins space to fold. The new assembly protocol that we are investigating &mdash; [[Team:Edinburgh/BioSandwich|BioSandwich]] &mdash; should be ideal for this.<br />
<br />
===Complete system===<br />
<br />
The complete 3 cellulase system could contain a promoter, driving expression of three coding fusions:<br />
<br />
* INP -- (Linker) -- endoglucanase (e.g. [http://partsregistry.org/Part:BBa_K392006 BBa_K392006])<br />
* INP -- (Linker) -- exoglucanase (e.g. [http://partsregistry.org/Part:BBa_K392007 BBa_K392007])<br />
* INP -- (Linker) -- &beta;-glucosidase (e.g. [http://partsregistry.org/Part:BBa_K392008 BBa_K392008])<br />
<br />
===An alternative: protein chains===<br />
<br />
[[File:INP-chain.png|thumb|center|600px|The protein chain idea: a long fusion protein is created with INP fused to (say) 3 enzymes in a row...]]<br />
<br />
Instead of making three different fusions, it might be possible to make one fusion that had all three cellulase enzymes linked together; we call this "beads on a string". As it happens, the exoglucanase (Cex) and the endoglucanase (CenA) both have a cellulose-binding module (CBM), but they are at different ends of the sequence. So here's the plan:<br />
<br />
* Create a fusion of:<br />
** '''Exoglucanase''' (catalytic domain) -- '''CBM''' -- '''Endoglucanase''' (catalytic domain)<br />
** This can be done by homology or by introducing an NcoI site into both Exo- and Endoglucanase at the appropriate locations, then ligating and doing fusion PCR.<br />
* We can then use KpnI in a similar way to attach a '''&beta;-glucosidase''' at either end.<br />
* Then attach INP.<br />
<br />
==Genetic instability==<br />
<br />
In order to display several different proteins on one bacterium using the first strategy, it will be necessary to have several copies of the INP gene fused to different enzymes. The presence of repeated sequences on a plasmid can lead to genetic instability.<br />
<br />
This will not be a problem in the JM109 lab strain, which lacks an important <span class="hardword" id="recombination">recombination</span> enzyme. As for the use of this technology in industry, it will be possible to overcome this problem simply by synthesising coding sequences with as many altered (but <span class="hardword" id="synonymouscodon">synonymous</span>) codons as possible. We have written a software tool for designing such sequences... see the [[Team:Edinburgh/Genetic instability|genetic instability]] page.<br />
<br />
==Proof of concept: YFP==<br />
<br />
As far as we know, nobody has used [http://partsregistry.org/Part:BBa_K265008 BBa_K265008] for cell display. We could prove that it works by simply displaying the Yellow Fluorescent Protein on INP. Indeed, something similar was achieved by [http://www.postech.edu/~hjcha/INP-N-GFP-OPH.pdf Li ''et al'' (2004)] and [http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.2009.01724.x/abstract Li ''et al'' (2009)] for a different version of the gene.<br />
<br />
==Conceptual animation==<br />
<br />
<html><body><br />
<object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" <br />
<br />
codebase="http://download.macromedia.com/pub/shockwave/<br />
cabs/flash/swflash.cab#version=6,0,40,0" <br />
<br />
width="468" height="60" <br />
id="mymoviename"> <br />
<br />
<param name="movie" <br />
<br />
value="https://static.igem.org/mediawiki/2011/1/17/INP_web_compressed.swf" /> <br />
<br />
<param name="quality" value="high" /> <br />
<br />
<param name="bgcolor" value="#ffffff" /> <br />
<br />
<embed src="https://static.igem.org/mediawiki/2011/1/17/INP_web_compressed.swf" quality="high" bgcolor="#ffffff"<br />
<br />
width="725" height="300" <br />
<br />
name="mymoviename" align="" type="application/x-shockwave-flash" <br />
<br />
pluginspage="http://www.macromedia.com/go/getflashplayer"> <br />
<br />
</embed> <br />
</object> <br />
</body><br />
</html><br />
<br />
<br />
==Results==<br />
<br />
Please see the team's [[Team:Edinburgh/Data | Data Page]] for information about how far we got with this project.<br />
<br />
==References==<br />
<br />
* Li L, Kang DG, Cha HJ (2004) [http://www.postech.edu/~hjcha/INP-N-GFP-OPH.pdf Functional display of foreign protein on surface of ''Escherichia coli'' using N-terminal domain of Ice Nucleation Protein]. ''Biotechnology and Bioengineering'' '''85'''(2): 214-221 (doi: 10.1002/bit.10892).<br />
<br />
* Li Q, Yu Z, Shao X, He J, Li L (2009) [http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.2009.01724.x/abstract Improved phosphate biosorption by bacterial surface display of phosphate-binding protein utilizing ice nucleation protein]. ''FEMS Microbiology Letters'' '''299'''(1): 44-52 (doi: 10.1111/j.1574-6968.2009.01724.x).<br />
<br />
* Van Bloois E, Winter RT, Kolmar H, Fraaije MW (2011) [http://www.sciencedirect.com/science/article/pii/S016777991000199X Decorating microbes: surface display of proteins on ''Escherichia coli'']. ''Trends in Biotechnology'' '''29'''(2): 79-86 (doi: 10.1016/j.tibtech.2010.11.003).<br />
<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Phage_DisplayTeam:Edinburgh/Phage Display2011-10-28T17:33:34Z<p>Allancrossman: /* Conceptual animation */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('home', 'home_phage');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Phage Display: Proposals</p><br />
<br />
The second system our feasibility study will examine, while searching for a way to keep extracellular enzymes close together, is based on displaying proteins on a <span class="hardword" id="phage">bacteriophage</span>. This type of display is called "phage display".<br />
<br />
==Outline==<br />
<br />
[[File:M13 with enzymes.png|center|thumb|600px|caption|This is what we want to build: phage with enzymes fused to the protein coat.]]<br />
<br />
The project will use phage <span class="hardword" id="m13">M13</span>, which is non-lytic (does not kill the bacteria). The entire genome is known (e.g. [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/M13MP18.SEQ.html here] is the entire M13mp18 genome) so primers can be designed. New England Bioworks [http://www.neb.com/nebecomm/tech_reference/protein_tools/phdFaq.asp#1.6 claims]:<br />
<br />
: ''"The major coat protein <span class="hardword" id="p8">pVIII</span> is present at ~2700 copies per virion, of which ~10% can be reliably fused to peptides or proteins."''<br />
<br />
We would infect our <span class="hardword" id="ec">E. coli</span> with wildtype phage. Our ''E. coli'' would have a plasmid coding for a fusion between an enzyme and pVIII. Proteins can be fused to pVIII at its amino terminal (i.e. 5' end in the DNA), according to [http://www.utoronto.ca/sidhulab/pdf/08.pdf Weiss and Sidhu, 2000]. pVIII has a leader peptide ([http://www.uniprot.org/uniprot/P69541 residues 1-23]) that is cleaved out, slightly complicating fusion design.<br />
<br />
To attach several different proteins to the phage, different fusions can be created and all of them expressed on the plasmid.<br />
<br />
We would need to tune expression levels of the fusions versus the wildtype protein.<br />
<br />
===The F plasmid===<br />
<br />
M13 can only infect ''E. coli'' if it has a sex pilus. This is coded for by the <span class="hardword" id="f">F plasmid</span>. However, such plasmids are quickly lost from cultures in a laboratory setting, as they confer a fitness cost. The JM109 strain has proline synthesis genes (proAB) absent from its main chromosome, but present on the F plasmid, and so when it is grown on minimal media, the plasmid will not be lost, as it is needed to keep the bacteria alive.<br />
<br />
===Genetic instability===<br />
<br />
In order to display several different proteins on one phage, it will be necessary to have several copies of the pVIII gene fused to different enzymes. The presence of repeated sequences on a plasmid can lead to genetic instability.<br />
<br />
This will not be a problem in the JM109 lab strain, which lacks an important <span class="hardword" id="recombination">recombination</span> enzyme. As for the use of this technology in industry, it will be possible to overcome this problem simply by synthesising coding sequences with as many altered (but <span class="hardword" id="synonymouscodon">synonymous</span>) codons as possible. We have written a software tool for designing such sequences... see the [[Team:Edinburgh/Genetic Instability|genetic instability]] page.<br />
<br />
==Bead reactors==<br />
<br />
Maurice Gallagher, one of our university's phage experts, suggests a different approach: make several strains of bacteria each producing phage with just one type of pVIII-fusion. But also make each phage have a <span class="hardword" id="p3">pIII</span>-fusion with a protein which could bind some sort of bead. The bead now becomes the complete "reactor". Since each bacteria codes for only one pVIII fusion, there is no repeated sequence problem.<br />
<br />
<br />
[[File:P3-bead-link.png|center|thumb|462px|caption|Detail of M13 attached to a bead. We would link multiple phages to the bead; each phage would carry one enzyme type only.]]<br />
<br />
==Problems==<br />
<br />
The question is how efficiently fusions to pVIII can get onto the phage. There are some dire warnings in the literature:<br />
<br />
* ''In our experience, most large proteins display well below one copy per phage particle.'' &mdash; [http://www.sciencedirect.com/science/article/pii/S0022283699934654 Sidhu et al (2000)]<br />
* ''A large 20 kDa protein (human growth hormone, hGH) is not displayed at detectable levels.'' &mdash; [http://www.utoronto.ca/sidhulab/pdf/08.pdf Weiss and Sidhu (2000)]<br />
* ''The properties of the pIV channel may be one of the factors that limit the size of polypeptides that can be displayed on pVIII.'' &mdash; [http://www.immun.lth.se/fileadmin/immun/Avhandlingar/Fredrik_Karlsson.pdf Karlsson (2004)]<br />
* ''As a general rule, the minor coat proteins will display larger proteins more effectively than pVIII.'' &mdash; [http://pubs.acs.org/doi/full/10.1021/cr000261r Kehoe and Kay (2005)]<br />
* ''[It is plausible] that a phage containing pVIII with a large peptide may be too large in diameter to pass through the 7-nm pIV exit pore in the outer membrane.'' &mdash; Barbas ''et al'' (2001)<br />
* ''The pVIII site, although very popular for peptide phage display, is not suitable for the efficient display of large polypeptides such as antibodies.'' &mdash; [http://www.sciencedirect.com/science/article/pii/S0734975000000549 Benhar (2001)]<br />
<br />
However, Maurice seemed quite upbeat about the prospects when we met him. It's definitely the case that large stuff has been displayed, but the question is whether this is some sort of fluke that only occurs (say) once per phage (i.e. see the Sidhu quote above).<br />
<br />
===A possible solution: zipper adaptors===<br />
<br />
If things don't work well, a possible solution (or at least something to attempt) exists...<br />
<br />
MIT 2010 attached small "zipper" peptides to pVIII. Their intention was to join phage together. We could use this system to attach our enzymes of interest (i.e. our cellulases) to the phage indirectly, by fusing the enzyme to a zipper and pVIII to the corresponding zipper. The two zippers will attach if we can get them to meet physically.<br />
<br />
The basic idea is similar to that of [http://www.sciencedirect.com/science/article/pii/S0378111905000764 Paschke and Höhne (2005)] (see Figure 1) and especially [http://www.sciencedirect.com/science/article/pii/S0022283609014624 Wang ''et al'' (2010)].<br />
<br />
* Sequence for zipper GR1: EEKSRLLEKENRELEKIIAEKEERVSELRHQLQSVGGC (38)<br />
* Sequence for zipper GR2: TSRLEGLQSENHRLRMKITELDKDLEEVTMQLQDVGGC (38)<br />
<br />
The construct would then contain two coding sequences:<br />
<br />
* Promoter--RBS--Leader--GR2--pVIII<br />
* Promoter--RBS--Periplasm Signal--Enzyme--GR1<br />
<br />
==Testing==<br />
<br />
As proof of concept (i.e. something we can accomplish in a short time) it would be sufficient to get just one fusion protein working. We need to prove that the enzyme part is actually getting out of the cell, so we must demonstrate that some substance which cannot enter the cell is nevertheless being degraded.<br />
<br />
A fairly easy test would be to use a fusion of <span class="hardword" id="amylase">amylase</span> to pVIII, and assay for <span class="hardword" id="starch">starch</span> degradation. There is no amylase BioBrick (with DNA available) in the Registry, so we'd have to make it.<br />
<br />
==Example systems==<br />
<br />
A simple version of the system would work as follows:<br />
<br />
* ''E. coli'' are grown up containing a plasmid coding for a pVIII fusion gene, i.e:<br />
** Promoter--RBS--Leader--Amylase--(Linker?)--pVIII.<br />
* These ''E. coli'' are infected with M13.<br />
* They create new phage; some of the modified pVIII proteins incorporate into the capsid.<br />
<br />
More complex versions would either incorporate more pVIII fusions, or multiple strains all of which have a pIII-fusion to attach to beads.<br />
<br />
==Results==<br />
<br />
Please see the team's [[Team:Edinburgh/Data | Data Page]] for information about how far we got with this project.<br />
<br />
==References==<br />
<br />
* Barbas CF, ''et al'' (2001) ''Phage display: a laboratory manual.'' Cold Spring Harbor Laboratory Press.<br />
<br />
* Benhar I (2001) [http://www.sciencedirect.com/science/article/pii/S0734975000000549 Biotechnological applications of phage and cell display]. ''Biotechnology Advances'' '''19'''(1): 1-33 (doi: 10.1016/S0734-9750(00)00054-9).<br />
<br />
* Paschke M, Höhne W (2005) [http://www.sciencedirect.com/science/article/pii/S0378111905000764 A twin-arginine translocation (Tat)-mediated phage display system]. ''Gene'' '''350'''(1): 79-88 (doi: 10.1016/j.gene.2005.02.005).<br />
<br />
* Sidhu SS, Weiss GA, Wells JA (2000) [http://www.sciencedirect.com/science/article/pii/S0022283699934654 High copy display of large proteins on phage for functional selections]. ''Journal of Molecular Biology'' '''296'''(2): 487-495 (doi: 10.1006/jmbi.1999.3465).<br />
<br />
* Wang KC, Wang X, Zhong P, Luo PP (2010) [http://www.sciencedirect.com/science/article/pii/S0022283609014624 Adapter-directed display: a modular design for shuttling display on phage surfaces]. ''Journal of Molecular Biology'' '''395'''(5): 1088-1101 (doi: 10.1016/j.jmb.2009.11.068).<br />
<br />
* Weiss GA, Sidhu SS (2000) [http://www.utoronto.ca/sidhulab/pdf/08.pdf Design and evolution of artificial M13 coat proteins]. ''Journal of Molecular Biology'' '''300''': 213-219 (doi: 10.1006/jmbi.2000.3845).<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/User_talk:Yazbo91User talk:Yazbo912011-10-28T17:22:33Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_foo');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Yassen's talk page</p><br />
<br />
Oh hai.<br />
<br />
Some comments:<br />
<br />
* When you define steady state as meaning 99% of the cellulose is used up, it becomes unclear what it means for cellobiose or glucose.<br />
* You say Figure 3 shows cellobiose doesn't reach a steady state. But it goes to zero. If you mean it goes negative, you'll have to replot the graph to show that...<br />
* You say "Analysing steady state is important to find out whether a system accumulates excess mass or energy" - but we know it can't in reality, right, since this violates physics? Do you mean analysing steady state is important as a way of testing if the model is sane?<br />
<br />
<br />
[[User:Allancrossman|Allancrossman]] 16:38, 9 September 2011 (CDT)<br />
<br />
==Tables==<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment<br />
!Size (m<sup>3</sup>)<br />
!Cost constant (&pound;)<br />
!Index<br />
!Purchase cost (&pound;)<br />
!Number required<br />
!Total cost (&pound;)<br />
|-<br />
|Boiler<br />
|8<br />
|70<br />
|0.8<br />
|13,218.33<br />
|4<br />
|52,873.31<br />
|-<br />
|Reactor 1<br />
|4<br />
|18,5000<br />
|0.45<br />
|47,158.74<br />
|1<br />
|47,158.74<br />
|-<br />
|Reactor 2<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 3<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 4<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 5<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 6<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Tank 100-102<br />
|3.3<br />
|1,400<br />
|0.55<br />
|2,699.67<br />
|3<br />
|8099.01<br />
|-<br />
|Tank 103<br />
|93.2<br />
|1,400<br />
|0.55<br />
|16,955.35<br />
|1<br />
|16,955.35<br />
|-<br />
|Tank 104<br />
|40<br />
|1,400<br />
|0.55<br />
|10,647.83<br />
|1<br />
|10,647.83<br />
|-<br />
|Tank 105<br />
|147<br />
|1,400<br />
|0.55<br />
|21,784.75<br />
|1<br />
|21,784.75<br />
|-<br />
|Tank 106<br />
|17<br />
|1,400<br />
|0.55<br />
|6,650.82<br />
|1<br />
|6,650.82<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Factorial number<br />
!Item<br />
!Factor<br />
|-<br />
|f1<br />
|Equipment erection<br />
|0.45<br />
|-<br />
|f2<br />
|Piping<br />
|0.45<br />
|-<br />
|f3<br />
|Instrumentation<br />
|0.15<br />
|-<br />
|f4<br />
|Electrical<br />
|0.1<br />
|-<br />
|f5<br />
|Buildings, process<br />
|0.1<br />
|-<br />
|f6<br />
|Ancillary buildings<br />
|0.2<br />
|-<br />
|colspan="2"|<br />
|'''Total = 1.45'''<br />
|-<br />
|f10<br />
|Design and Engineering<br />
|0.25<br />
|-<br />
|f11<br />
|Contractor’s Fee<br />
|0.05<br />
|-<br />
|f12<br />
|Contingency<br />
|0.1<br />
|-<br />
|colspan="2"|<br />
|'''Total = 0.4'''<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Type<br />
!Amount<br />
!Unit price<br />
!Cost<br />
|-<br />
|Steam<br />
|200 kg/h<br />
|&pound;7/t<br />
|&pound;9811.2<br />
|-<br />
|Cooling water<br />
|3,000 kg/h<br />
|1.5p/t<br />
|&pound;315.36<br />
|-<br />
|Power<br />
|100 kWh/d<br />
|1.2p/mj<br />
|&pound;43,200<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment number<br />
!Equipment name<br />
!Comment<br />
|-<br />
|Tank 100,101,102<br />
|Feed storage tanks<br />
|Capacity: 3.3 m<sup>3</sup><br />
|-<br />
|Tank 103<br />
|Product storage tank<br />
|Capacity: 93.2 m<sup>3</sup><br />
|-<br />
|Tank 104<br />
|Product storage tank<br />
|Capacity: 40 m<sup>3</sup><br />
|-<br />
|Tank 105<br />
|Product storage tank<br />
|Capacity: 147 m<sup>3</sup><br />
|-<br />
|Tank 106<br />
|Product storage tank<br />
|Capacity: 17 m<sup>3</sup><br />
|-<br />
|colspan="3"|&nbsp;<br />
|-<br />
|R-1<br />
|Pre-treatment reactor<br />
|Capacity:8 m<sup>3</sup>, 140 C, 20 bar<br />
|-<br />
|R-2<br />
|Thermal depolymerisation of hemicellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-3<br />
|Hydrous pyrolysis of lignin<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-4<br />
|Degradation of cellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-5<br />
|Conversion of glucose to sorbitol<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-6<br />
|Conversion of glucose to fructose syrup<br />
|Capacity 4 m<sup>3</sup><br />
|-<br />
|P-1, P-2<br />
|Pumps<br />
|<br />
|-<br />
|D-1<br />
|Recovery column <br />
|1 bar<br />
|-<br />
|HE-1, 2, 3, 4<br />
|Heat exchangers<br />
|<br />
|-<br />
|LI-1, 2, 3, 4, 5, 6, 7, 8, 9<br />
|Level indicators<br />
|PID control<br />
|-<br />
|TI-1, 2, 3, 4, 5, 6<br />
|Temperature indicators<br />
|PID control<br />
|-<br />
|FI-1 to FI-15<br />
|Flow indicators<br />
|PID control<br />
|-<br />
|V-1, 2, 3, 6, 7, 8<br />
|Mixing valve<br />
|<br />
|-<br />
|V-4, 5<br />
|Angle valve<br />
|<br />
|-<br />
|V-9 to V-42<br />
|Gate valve<br />
|<br />
|}<br />
<br />
<br />
End of tables.<br />
<br />
----<br />
<br />
I moved that to [[Team:Edinburgh/Phage_Display]] though it looks terrible on a smallish screen. And too much whitespace on left and right edges... [[User:Allancrossman|Allancrossman]] 12:22, 28 October 2011 (CDT)<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/User_talk:Yazbo91User talk:Yazbo912011-10-28T17:22:13Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('team', 'team_foo');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Yassen's talk page</p><br />
<br />
Oh hai.<br />
<br />
Some comments:<br />
<br />
* When you define steady state as meaning 99% of the cellulose is used up, it becomes unclear what it means for cellobiose or glucose.<br />
* You say Figure 3 shows cellobiose doesn't reach a steady state. But it goes to zero. If you mean it goes negative, you'll have to replot the graph to show that...<br />
* You say "Analysing steady state is important to find out whether a system accumulates excess mass or energy" - but we know it can't in reality, right, since this violates physics? Do you mean analysing steady state is important as a way of testing if the model is sane?<br />
<br />
<br />
[[User:Allancrossman|Allancrossman]] 16:38, 9 September 2011 (CDT)<br />
<br />
==Tables==<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment<br />
!Size (m<sup>3</sup>)<br />
!Cost constant (&pound;)<br />
!Index<br />
!Purchase cost (&pound;)<br />
!Number required<br />
!Total cost (&pound;)<br />
|-<br />
|Boiler<br />
|8<br />
|70<br />
|0.8<br />
|13,218.33<br />
|4<br />
|52,873.31<br />
|-<br />
|Reactor 1<br />
|4<br />
|18,5000<br />
|0.45<br />
|47,158.74<br />
|1<br />
|47,158.74<br />
|-<br />
|Reactor 2<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 3<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 4<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 5<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Reactor 6<br />
|4<br />
|18,500<br />
|0.45<br />
|34,522.22<br />
|1<br />
|34,522.22<br />
|-<br />
|Tank 100-102<br />
|3.3<br />
|1,400<br />
|0.55<br />
|2,699.67<br />
|3<br />
|8099.01<br />
|-<br />
|Tank 103<br />
|93.2<br />
|1,400<br />
|0.55<br />
|16,955.35<br />
|1<br />
|16,955.35<br />
|-<br />
|Tank 104<br />
|40<br />
|1,400<br />
|0.55<br />
|10,647.83<br />
|1<br />
|10,647.83<br />
|-<br />
|Tank 105<br />
|147<br />
|1,400<br />
|0.55<br />
|21,784.75<br />
|1<br />
|21,784.75<br />
|-<br />
|Tank 106<br />
|17<br />
|1,400<br />
|0.55<br />
|6,650.82<br />
|1<br />
|6,650.82<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Factorial number<br />
!Item<br />
!Factor<br />
|-<br />
|f1<br />
|Equipment erection<br />
|0.45<br />
|-<br />
|f2<br />
|Piping<br />
|0.45<br />
|-<br />
|f3<br />
|Instrumentation<br />
|0.15<br />
|-<br />
|f4<br />
|Electrical<br />
|0.1<br />
|-<br />
|f5<br />
|Buildings, process<br />
|0.1<br />
|-<br />
|f6<br />
|Ancillary buildings<br />
|0.2<br />
|-<br />
|colspan="2"|<br />
|'''Total = 1.45'''<br />
|-<br />
|f10<br />
|Design and Engineering<br />
|0.25<br />
|-<br />
|f11<br />
|Contractor’s Fee<br />
|0.05<br />
|-<br />
|f12<br />
|Contingency<br />
|0.1<br />
|-<br />
|colspan="2"|<br />
|'''Total = 0.4'''<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Type<br />
!Amount<br />
!Unit price<br />
!Cost<br />
|-<br />
|Steam<br />
|200 kg/h<br />
|&pound;7/t<br />
|&pound;9811.2<br />
|-<br />
|Cooling water<br />
|3,000 kg/h<br />
|1.5p/t<br />
|&pound;315.36<br />
|-<br />
|Power<br />
|100 kWh/d<br />
|1.2p/mj<br />
|&pound;43,200<br />
|}<br />
<br />
{| class="wikitable centredtext"<br />
|-<br />
!Equipment number<br />
!Equipment name<br />
!Comment<br />
|-<br />
|Tank 100,101,102<br />
|Feed storage tanks<br />
|Capacity: 3.3 m<sup>3</sup><br />
|-<br />
|Tank 103<br />
|Product storage tank<br />
|Capacity: 93.2 m<sup>3</sup><br />
|-<br />
|Tank 104<br />
|Product storage tank<br />
|Capacity: 40 m<sup>3</sup><br />
|-<br />
|Tank 105<br />
|Product storage tank<br />
|Capacity: 147 m<sup>3</sup><br />
|-<br />
|Tank 106<br />
|Product storage tank<br />
|Capacity: 17 m<sup>3</sup><br />
|-<br />
|colspan="3"|&nbsp;<br />
|-<br />
|R-1<br />
|Pre-treatment reactor<br />
|Capacity:8 m<sup>3</sup>, 140 C, 20 bar<br />
|-<br />
|R-2<br />
|Thermal depolymerisation of hemicellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-3<br />
|Hydrous pyrolysis of lignin<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-4<br />
|Degradation of cellulose<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-5<br />
|Conversion of glucose to sorbitol<br />
|Capacity: 4 m<sup>3</sup><br />
|-<br />
|R-6<br />
|Conversion of glucose to fructose syrup<br />
|Capacity 4 m<sup>3</sup><br />
|-<br />
|P-1, P-2<br />
|Pumps<br />
|<br />
|-<br />
|D-1<br />
|Recovery column <br />
|1 bar<br />
|-<br />
|HE-1, 2, 3, 4<br />
|Heat exchangers<br />
|<br />
|-<br />
|LI-1, 2, 3, 4, 5, 6, 7, 8, 9<br />
|Level indicators<br />
|PID control<br />
|-<br />
|TI-1, 2, 3, 4, 5, 6<br />
|Temperature indicators<br />
|PID control<br />
|-<br />
|FI-1 to FI-15<br />
|Flow indicators<br />
|PID control<br />
|-<br />
|V-1, 2, 3, 6, 7, 8<br />
|Mixing valve<br />
|<br />
|-<br />
|V-4, 5<br />
|Angle valve<br />
|<br />
|-<br />
|V-9 to V-42<br />
|Gate valve<br />
|<br />
|}<br />
<br />
<br />
End of tables.<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html><br />
<br />
----<br />
<br />
I moved that to [[Team:Edinburgh/Phage_Display]] though it looks terrible on a smallish screen. And too much whitespace on left and right edges... [[User:Allancrossman|Allancrossman]] 12:22, 28 October 2011 (CDT)</div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Phage_DisplayTeam:Edinburgh/Phage Display2011-10-28T17:21:10Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('home', 'home_phage');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Phage Display: Proposals</p><br />
<br />
The second system our feasibility study will examine, while searching for a way to keep extracellular enzymes close together, is based on displaying proteins on a <span class="hardword" id="phage">bacteriophage</span>. This type of display is called "phage display".<br />
<br />
==Outline==<br />
<br />
[[File:M13 with enzymes.png|center|thumb|600px|caption|This is what we want to build: phage with enzymes fused to the protein coat.]]<br />
<br />
The project will use phage <span class="hardword" id="m13">M13</span>, which is non-lytic (does not kill the bacteria). The entire genome is known (e.g. [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/M13MP18.SEQ.html here] is the entire M13mp18 genome) so primers can be designed. New England Bioworks [http://www.neb.com/nebecomm/tech_reference/protein_tools/phdFaq.asp#1.6 claims]:<br />
<br />
: ''"The major coat protein <span class="hardword" id="p8">pVIII</span> is present at ~2700 copies per virion, of which ~10% can be reliably fused to peptides or proteins."''<br />
<br />
We would infect our <span class="hardword" id="ec">E. coli</span> with wildtype phage. Our ''E. coli'' would have a plasmid coding for a fusion between an enzyme and pVIII. Proteins can be fused to pVIII at its amino terminal (i.e. 5' end in the DNA), according to [http://www.utoronto.ca/sidhulab/pdf/08.pdf Weiss and Sidhu, 2000]. pVIII has a leader peptide ([http://www.uniprot.org/uniprot/P69541 residues 1-23]) that is cleaved out, slightly complicating fusion design.<br />
<br />
To attach several different proteins to the phage, different fusions can be created and all of them expressed on the plasmid.<br />
<br />
We would need to tune expression levels of the fusions versus the wildtype protein.<br />
<br />
===The F plasmid===<br />
<br />
M13 can only infect ''E. coli'' if it has a sex pilus. This is coded for by the <span class="hardword" id="f">F plasmid</span>. However, such plasmids are quickly lost from cultures in a laboratory setting, as they confer a fitness cost. The JM109 strain has proline synthesis genes (proAB) absent from its main chromosome, but present on the F plasmid, and so when it is grown on minimal media, the plasmid will not be lost, as it is needed to keep the bacteria alive.<br />
<br />
===Genetic instability===<br />
<br />
In order to display several different proteins on one phage, it will be necessary to have several copies of the pVIII gene fused to different enzymes. The presence of repeated sequences on a plasmid can lead to genetic instability.<br />
<br />
This will not be a problem in the JM109 lab strain, which lacks an important <span class="hardword" id="recombination">recombination</span> enzyme. As for the use of this technology in industry, it will be possible to overcome this problem simply by synthesising coding sequences with as many altered (but <span class="hardword" id="synonymouscodon">synonymous</span>) codons as possible. We have written a software tool for designing such sequences... see the [[Team:Edinburgh/Genetic Instability|genetic instability]] page.<br />
<br />
==Bead reactors==<br />
<br />
Maurice Gallagher, one of our university's phage experts, suggests a different approach: make several strains of bacteria each producing phage with just one type of pVIII-fusion. But also make each phage have a <span class="hardword" id="p3">pIII</span>-fusion with a protein which could bind some sort of bead. The bead now becomes the complete "reactor". Since each bacteria codes for only one pVIII fusion, there is no repeated sequence problem.<br />
<br />
<br />
[[File:P3-bead-link.png|center|thumb|462px|caption|Detail of M13 attached to a bead. We would link multiple phages to the bead; each phage would carry one enzyme type only.]]<br />
<br />
==Problems==<br />
<br />
The question is how efficiently fusions to pVIII can get onto the phage. There are some dire warnings in the literature:<br />
<br />
* ''In our experience, most large proteins display well below one copy per phage particle.'' &mdash; [http://www.sciencedirect.com/science/article/pii/S0022283699934654 Sidhu et al (2000)]<br />
* ''A large 20 kDa protein (human growth hormone, hGH) is not displayed at detectable levels.'' &mdash; [http://www.utoronto.ca/sidhulab/pdf/08.pdf Weiss and Sidhu (2000)]<br />
* ''The properties of the pIV channel may be one of the factors that limit the size of polypeptides that can be displayed on pVIII.'' &mdash; [http://www.immun.lth.se/fileadmin/immun/Avhandlingar/Fredrik_Karlsson.pdf Karlsson (2004)]<br />
* ''As a general rule, the minor coat proteins will display larger proteins more effectively than pVIII.'' &mdash; [http://pubs.acs.org/doi/full/10.1021/cr000261r Kehoe and Kay (2005)]<br />
* ''[It is plausible] that a phage containing pVIII with a large peptide may be too large in diameter to pass through the 7-nm pIV exit pore in the outer membrane.'' &mdash; Barbas ''et al'' (2001)<br />
* ''The pVIII site, although very popular for peptide phage display, is not suitable for the efficient display of large polypeptides such as antibodies.'' &mdash; [http://www.sciencedirect.com/science/article/pii/S0734975000000549 Benhar (2001)]<br />
<br />
However, Maurice seemed quite upbeat about the prospects when we met him. It's definitely the case that large stuff has been displayed, but the question is whether this is some sort of fluke that only occurs (say) once per phage (i.e. see the Sidhu quote above).<br />
<br />
===A possible solution: zipper adaptors===<br />
<br />
If things don't work well, a possible solution (or at least something to attempt) exists...<br />
<br />
MIT 2010 attached small "zipper" peptides to pVIII. Their intention was to join phage together. We could use this system to attach our enzymes of interest (i.e. our cellulases) to the phage indirectly, by fusing the enzyme to a zipper and pVIII to the corresponding zipper. The two zippers will attach if we can get them to meet physically.<br />
<br />
The basic idea is similar to that of [http://www.sciencedirect.com/science/article/pii/S0378111905000764 Paschke and Höhne (2005)] (see Figure 1) and especially [http://www.sciencedirect.com/science/article/pii/S0022283609014624 Wang ''et al'' (2010)].<br />
<br />
* Sequence for zipper GR1: EEKSRLLEKENRELEKIIAEKEERVSELRHQLQSVGGC (38)<br />
* Sequence for zipper GR2: TSRLEGLQSENHRLRMKITELDKDLEEVTMQLQDVGGC (38)<br />
<br />
The construct would then contain two coding sequences:<br />
<br />
* Promoter--RBS--Leader--GR2--pVIII<br />
* Promoter--RBS--Periplasm Signal--Enzyme--GR1<br />
<br />
==Testing==<br />
<br />
As proof of concept (i.e. something we can accomplish in a short time) it would be sufficient to get just one fusion protein working. We need to prove that the enzyme part is actually getting out of the cell, so we must demonstrate that some substance which cannot enter the cell is nevertheless being degraded.<br />
<br />
A fairly easy test would be to use a fusion of <span class="hardword" id="amylase">amylase</span> to pVIII, and assay for <span class="hardword" id="starch">starch</span> degradation. There is no amylase BioBrick (with DNA available) in the Registry, so we'd have to make it.<br />
<br />
==Example systems==<br />
<br />
A simple version of the system would work as follows:<br />
<br />
* ''E. coli'' are grown up containing a plasmid coding for a pVIII fusion gene, i.e:<br />
** Promoter--RBS--Leader--Amylase--(Linker?)--pVIII.<br />
* These ''E. coli'' are infected with M13.<br />
* They create new phage; some of the modified pVIII proteins incorporate into the capsid.<br />
<br />
More complex versions would either incorporate more pVIII fusions, or multiple strains all of which have a pIII-fusion to attach to beads.<br />
<br />
==Conceptual animation==<br />
<br />
<html><body><br />
<object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" <br />
<br />
codebase="http://download.macromedia.com/pub/shockwave/<br />
cabs/flash/swflash.cab#version=6,0,40,0" <br />
<br />
width="468" height="60" <br />
id="mymoviename"> <br />
<br />
<param name="movie" <br />
<br />
value="https://static.igem.org/mediawiki/2011/1/17/INP_web_compressed.swf" /> <br />
<br />
<param name="quality" value="high" /> <br />
<br />
<param name="bgcolor" value="#ffffff" /> <br />
<br />
<embed src="https://static.igem.org/mediawiki/2011/1/17/INP_web_compressed.swf" quality="high" bgcolor="#ffffff"<br />
<br />
width="725" height="300" <br />
<br />
name="mymoviename" align="" type="application/x-shockwave-flash" <br />
<br />
pluginspage="http://www.macromedia.com/go/getflashplayer"> <br />
<br />
</embed> <br />
</object> <br />
</body><br />
</html><br />
<br />
==Results==<br />
<br />
Please see the team's [[Team:Edinburgh/Data | Data Page]] for information about how far we got with this project.<br />
<br />
==References==<br />
<br />
* Barbas CF, ''et al'' (2001) ''Phage display: a laboratory manual.'' Cold Spring Harbor Laboratory Press.<br />
<br />
* Benhar I (2001) [http://www.sciencedirect.com/science/article/pii/S0734975000000549 Biotechnological applications of phage and cell display]. ''Biotechnology Advances'' '''19'''(1): 1-33 (doi: 10.1016/S0734-9750(00)00054-9).<br />
<br />
* Paschke M, Höhne W (2005) [http://www.sciencedirect.com/science/article/pii/S0378111905000764 A twin-arginine translocation (Tat)-mediated phage display system]. ''Gene'' '''350'''(1): 79-88 (doi: 10.1016/j.gene.2005.02.005).<br />
<br />
* Sidhu SS, Weiss GA, Wells JA (2000) [http://www.sciencedirect.com/science/article/pii/S0022283699934654 High copy display of large proteins on phage for functional selections]. ''Journal of Molecular Biology'' '''296'''(2): 487-495 (doi: 10.1006/jmbi.1999.3465).<br />
<br />
* Wang KC, Wang X, Zhong P, Luo PP (2010) [http://www.sciencedirect.com/science/article/pii/S0022283609014624 Adapter-directed display: a modular design for shuttling display on phage surfaces]. ''Journal of Molecular Biology'' '''395'''(5): 1088-1101 (doi: 10.1016/j.jmb.2009.11.068).<br />
<br />
* Weiss GA, Sidhu SS (2000) [http://www.utoronto.ca/sidhulab/pdf/08.pdf Design and evolution of artificial M13 coat proteins]. ''Journal of Molecular Biology'' '''300''': 213-219 (doi: 10.1006/jmbi.2000.3845).<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/DataTeam:Edinburgh/Data2011-10-28T17:20:59Z<p>Allancrossman: /* Progress */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab','lab_data');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Data Overview</p> <!-- see https://igem.org/Sample_Data_Page for example page. --><br />
<br />
This page provides an overview of the purely biological aspects of our feasibility study, and links to the relevant Parts Registry pages.<br />
<br />
==Cell Surface Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Cell Display | Cell Surface Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them at high copy number on the cell's outer membrane. <span class="hardword" id="inp">Ice Nucleation Protein</span> is used as a carrier for display of the enzymes; it carries them to the outer membrane.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Cell-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''INP&mdash;Endoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523011 BBa_K523011])<br><br />
&nbsp; &nbsp; an '''INP&mdash;&beta;-glucosidase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523004 BBa_K523004])<br><br />
&nbsp; &nbsp; an '''INP&mdash;Exoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523009 BBa_K523009])<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals.<br><br><br />
Cellulose degradation is shown at the bottom. In reality, tens of thousands of enzymes will cover the outer membrane in random places.<br><br>A test system to prove that [http://partsregistry.org/Part:BBa_K523008 BBa_K523008] can be used to carry proteins to the outer membrane uses a fusion of INP to '''Yellow Fluorescent Protein (YFP)''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Shown that INP ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008], based on [http://partsregistry.org/Part:BBa_K265008 BBa_K265008]) can be used to carry proteins to the cell membrane, by constructing [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
* Made and tested a new &beta;-glucosidase ''(bglX)'' BioBrick, [http://partsregistry.org/Part:BBa_K523002 BBa_K523002].<br />
* Made ''bglX'' into a format compatible with our BioSandwich assembly protocol ([http://partsregistry.org/Part:BBa_K523004 BBa_K523004]).<br />
* Made new versions of other cellulases, in a format compatible with the BioSandwich protocol.<br />
* Tested an old exoglucanase gene, [http://partsregistry.org/Part:BBa_K118022 BBa_K118022].<br />
* Made fusions of INP to ''bglX'' (&beta;-glucosidase) and ''cex'' (exoglucanase).<br />
* Made a fusion of ''cex'' to ''cenA'' ([http://partsregistry.org/Part:BBa_K523025 BBa_K523025]).<br />
<br />
==Phage Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Phage Display | Phage Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them on an <span class="hardword" id="m13">M13</span> <span class="hardword" id="phage">phage</span>. The major coat protein <span class="hardword" id="p8">pVIII</span> is used as a carrier for display of the enzymes; it incorporates them into the phage.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Phage-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''Endoglucanase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; a '''&beta;-glucosidase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; an '''Exoglucanase&mdash;pVIII''' fusion<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals. '''"Signal"''' means a periplasmic signal sequence, directing the protein to the periplasm to be assembled into the phage.<br><br>A test system uses a fusion of pVIII to ''E. coli'' amylase '''MalS''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Made and tested a new amylase ''(malS)'' BioBrick, [http://partsregistry.org/Part:BBa_K523001 BBa_K523001].<br />
* Attempted to fuse it to the major coat protein pVIII.<br />
<br />
==BioSandwich==<br />
<br />
[[Team:Edinburgh/BioSandwich | BioSandwich]] ([[:File:RFC81.pdf|RFC 81]]) is a new assembly protocol that we used.<br />
<br />
Parts made using BioSandwich that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
==Favourite BioBricks==<br />
<br />
(A complete list of parts made during the project is found at the dedicated [[Team:Edinburgh/Parts | Parts]] page.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523000 BBa_K523000]: Plac + lacZ; with BglII site'''<br />
: Intended as a cloning vector (when present in pSB1C3), this part allows Blue/White selection of newly PCR'ed BioBricks. The PCR primers required are shorter than would be required using the standard method. It encodes LacZ&alpha;; new BioBricks that have successfully replaced the part will be white on plates containing IPTG and Xgal. Parts created in this way will also be compatible with the BioSandwich assembly protocol. We proved this part worked by using it to create several other BioBricks.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523006 BBa_K523006]: Plac + malS'''<br />
: ''malS'' is a <span class="hardword" id="periplasm">periplasmic</span> ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found evidence of <span class="hardword" id="starch">starch</span> degrading activity.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: Plac + INP-EYFP'''<br />
: A fusion of Ice Nucleation Protein and Enhanced Yellow Fluorescent Protein under the control of the Lac promoter. Fluoresces yellow under blue light. May be localised to the outer membrane.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523014 BBa_K523014]: Plac + bglX'''<br />
: ''bglX'' is a <span class="hardword" id="cryptic">cryptic</span> &beta;-glucosidase gene from ''E. coli''. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found it to be capable of degrading the <span class="hardword" id="cellobiose">cellobiose</span> analog, MUG.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523025 BBa_K523025]: Plac + cxnA'''<br />
: ''cxnA'' is a fusion we constructed (in line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal), containing an exoglucanase and an endoglucanse; it was found to have the functions of both enzymes.<br />
<br />
==Other BioBricks analysed==<br />
<br />
(More details of this are found at the dedicated [[Team:Edinburgh/Collaboration | Collaboration]] page. The information has also been added to the parts' "Experience" sections.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K118022:Experience BBa_K118022]: ''C. fimi'' exoglucanase'''<br />
: At the same time as we tested ''bglX'' for activity, we also tested this old part's ability to degrade the cellobiose analog MUG (weak ability) and the cellulose analog MUC (strong ability).<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K415151:Experience BBa_K415151]: p8-GR1'''<br />
: Supposed to encode a fusion of the pVIII protein to a GR1 zipper. It actually encodes part of the ''E. coli'' aminopeptidase N gene.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K392008:Experience BBa_K392008]: ''C. fimi'' &beta;-glucosidase'''<br />
: We discovered that this part almost certainly starts its coding sequence at the second ATG present, not the first. This is highly relevant information for anyone trying to tune its expression via use of custom Ribosome Binding Sites.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K265008:Experience BBa_K265008]: Ice Nucleation Protein'''<br />
: We successfully used this part, fusing it to Enhanced Yellow Fluorescent Protein, which was apparently transported to the outer membrane as a result.<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/DataTeam:Edinburgh/Data2011-10-28T12:24:18Z<p>Allancrossman: /* Progress */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab','lab_data');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Data Overview</p> <!-- see https://igem.org/Sample_Data_Page for example page. --><br />
<br />
This page provides an overview of the purely biological aspects of our feasibility study, and links to the relevant Parts Registry pages.<br />
<br />
==Cell Surface Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Cell Display | Cell Surface Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them at high copy number on the cell's outer membrane. <span class="hardword" id="inp">Ice Nucleation Protein</span> is used as a carrier for display of the enzymes; it carries them to the outer membrane.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Cell-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''INP&mdash;Endoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523011 BBa_K523011])<br><br />
&nbsp; &nbsp; an '''INP&mdash;&beta;-glucosidase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523004 BBa_K523004])<br><br />
&nbsp; &nbsp; an '''INP&mdash;Exoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523009 BBa_K523009])<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals.<br><br><br />
Cellulose degradation is shown at the bottom. In reality, tens of thousands of enzymes will cover the outer membrane in random places.<br><br>A test system to prove that [http://partsregistry.org/Part:BBa_K523008 BBa_K523008] can be used to carry proteins to the outer membrane uses a fusion of INP to '''Yellow Fluorescent Protein (YFP)''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Shown that INP ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008], based on [http://partsregistry.org/Part:BBa_K265008 BBa_K265008]) can be used to carry proteins to the cell membrane, by constructing [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
* Made and tested a new &beta;-glucosidase ''(bglX)'' BioBrick, [http://partsregistry.org/Part:BBa_K523002 BBa_K523002].<br />
* Made ''bglX'' into a format compatible with our BioSandwich assembly protocol ([http://partsregistry.org/Part:BBa_K523004 BBa_K523004]).<br />
* Made new versions of other cellulases, in a format compatible with the BioSandwich protocol.<br />
* Tested an old exoglucanase gene, [http://partsregistry.org/Part:BBa_K118022 BBa_K118022].<br />
* Made fusions of INP to ''bglX'' (&beta;-glucosidase) and ''cex'' (exoglucanase).<br />
* Made a fusion of ''cex'' to ''cenA'' ([http://partsregistry.org/Part:BBa_K523025 BBa_K523025]).<br />
<br />
==Phage Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Phage Display | Phage Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them on an <span class="hardword" id="m13">M13</span> <span class="hardword" id="phage">phage</span>. The major coat protein <span class="hardword" id="p8">pVIII</span> is used as a carrier for display of the enzymes; it incorporates them into the phage.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Phage-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''Endoglucanase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; a '''&beta;-glucosidase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; an '''Exoglucanase&mdash;pVIII''' fusion<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals. '''"Signal"''' means a periplasmic signal sequence, directing the protein to the periplasm to be assembled into the phage.<br><br>A test system uses a fusion of pVIII to ''E. coli'' amylase '''MalS''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Made and tested a new amylase ''(malS)'' BioBrick, [http://partsregistry.org/Part:BBa_K523001 BBa_K523001].<br />
* Attempted to fuse it to the major coat protein pVIII.<br />
<br />
==BioSandwich==<br />
<br />
[[Team:Edinburgh/BioSandwich | BioSandwich]] ([[:File:RFC81.pdf|RFC 81]]) is a new assembly protocol that we used.<br />
<br />
Parts made using BioSandwich that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
==Favourite BioBricks==<br />
<br />
(A complete list of parts made during the project is found at the dedicated [[Team:Edinburgh/Parts | Parts]] page.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523000 BBa_K523000]: Plac + lacZ; with BglII site'''<br />
: Intended as a cloning vector (when present in pSB1C3), this part allows Blue/White selection of newly PCR'ed BioBricks. The PCR primers required are shorter than would be required using the standard method. It encodes LacZ&alpha;; new BioBricks that have successfully replaced the part will be white on plates containing IPTG and Xgal. Parts created in this way will also be compatible with the BioSandwich assembly protocol. We proved this part worked by using it to create several other BioBricks.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523006 BBa_K523006]: Plac + malS'''<br />
: ''malS'' is a <span class="hardword" id="periplasm">periplasmic</span> ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found evidence of <span class="hardword" id="starch">starch</span> degrading activity.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: Plac + INP-EYFP'''<br />
: A fusion of Ice Nucleation Protein and Enhanced Yellow Fluorescent Protein under the control of the Lac promoter. Fluoresces yellow under blue light. May be localised to the outer membrane.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523014 BBa_K523014]: Plac + bglX'''<br />
: ''bglX'' is a <span class="hardword" id="cryptic">cryptic</span> &beta;-glucosidase gene from ''E. coli''. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found it to be capable of degrading the <span class="hardword" id="cellobiose">cellobiose</span> analog, MUG.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523025 BBa_K523025]: Plac + cxnA'''<br />
: ''cxnA'' is a fusion we constructed (in line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal), containing an exoglucanase and an endoglucanse; it was found to have the functions of both enzymes.<br />
<br />
==Other BioBricks analysed==<br />
<br />
(More details of this are found at the dedicated [[Team:Edinburgh/Collaboration | Collaboration]] page. The information has also been added to the parts' "Experience" sections.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K118022:Experience BBa_K118022]: ''C. fimi'' exoglucanase'''<br />
: At the same time as we tested ''bglX'' for activity, we also tested this old part's ability to degrade the cellobiose analog MUG (weak ability) and the cellulose analog MUC (strong ability).<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K415151:Experience BBa_K415151]: p8-GR1'''<br />
: Supposed to encode a fusion of the pVIII protein to a GR1 zipper. It actually encodes part of the ''E. coli'' aminopeptidase N gene.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K392008:Experience BBa_K392008]: ''C. fimi'' &beta;-glucosidase'''<br />
: We discovered that this part almost certainly starts its coding sequence at the second ATG present, not the first. This is highly relevant information for anyone trying to tune its expression via use of custom Ribosome Binding Sites.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K265008:Experience BBa_K265008]: Ice Nucleation Protein'''<br />
: We successfully used this part, fusing it to Enhanced Yellow Fluorescent Protein, which was apparently transported to the outer membrane as a result.<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/DataTeam:Edinburgh/Data2011-10-28T12:24:09Z<p>Allancrossman: /* Progress */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab','lab_data');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Data Overview</p> <!-- see https://igem.org/Sample_Data_Page for example page. --><br />
<br />
This page provides an overview of the purely biological aspects of our feasibility study, and links to the relevant Parts Registry pages.<br />
<br />
==Cell Surface Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Cell Display | Cell Surface Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them at high copy number on the cell's outer membrane. <span class="hardword" id="inp">Ice Nucleation Protein</span> is used as a carrier for display of the enzymes; it carries them to the outer membrane.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Cell-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''INP&mdash;Endoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523011 BBa_K523011])<br><br />
&nbsp; &nbsp; an '''INP&mdash;&beta;-glucosidase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523004 BBa_K523004])<br><br />
&nbsp; &nbsp; an '''INP&mdash;Exoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523009 BBa_K523009])<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals.<br><br><br />
Cellulose degradation is shown at the bottom. In reality, tens of thousands of enzymes will cover the outer membrane in random places.<br><br>A test system to prove that [http://partsregistry.org/Part:BBa_K523008 BBa_K523008] can be used to carry proteins to the outer membrane uses a fusion of INP to '''Yellow Fluorescent Protein (YFP)''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Shown that INP ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008], based on [http://partsregistry.org/Part:BBa_K265008 BBa_K265008]) can be used to carry proteins to the cell membrane, by constructing [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
* Made and tested a new &beta;-glucosidase ''(bglX)'' BioBrick, [http://partsregistry.org/Part:BBa_K523002 BBa_K523002].<br />
* Made ''bglX'' into a format compatible with our BioSandwich assembly protocol ([http://partsregistry.org/Part:BBa_K523004 BBa_K523004]).<br />
* Made new versions of other cellulases, in a format compatible with the BioSandwich protocol.<br />
* Tested an old exoglucanase gene, [http://partsregistry.org/Part:BBa_K118022 BBa_K118022].<br />
* Made fusions of INP to ''bglX'' (&beta;-glucosidase) and ''cex'' (exoglucanase).<br />
* Made a fusion of ''cex'' to ''cenA'' ([http://partsregistry.org/Part:BBa_K523025 BBa_K523025].<br />
<br />
==Phage Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Phage Display | Phage Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them on an <span class="hardword" id="m13">M13</span> <span class="hardword" id="phage">phage</span>. The major coat protein <span class="hardword" id="p8">pVIII</span> is used as a carrier for display of the enzymes; it incorporates them into the phage.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Phage-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''Endoglucanase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; a '''&beta;-glucosidase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; an '''Exoglucanase&mdash;pVIII''' fusion<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals. '''"Signal"''' means a periplasmic signal sequence, directing the protein to the periplasm to be assembled into the phage.<br><br>A test system uses a fusion of pVIII to ''E. coli'' amylase '''MalS''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Made and tested a new amylase ''(malS)'' BioBrick, [http://partsregistry.org/Part:BBa_K523001 BBa_K523001].<br />
* Attempted to fuse it to the major coat protein pVIII.<br />
<br />
==BioSandwich==<br />
<br />
[[Team:Edinburgh/BioSandwich | BioSandwich]] ([[:File:RFC81.pdf|RFC 81]]) is a new assembly protocol that we used.<br />
<br />
Parts made using BioSandwich that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
==Favourite BioBricks==<br />
<br />
(A complete list of parts made during the project is found at the dedicated [[Team:Edinburgh/Parts | Parts]] page.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523000 BBa_K523000]: Plac + lacZ; with BglII site'''<br />
: Intended as a cloning vector (when present in pSB1C3), this part allows Blue/White selection of newly PCR'ed BioBricks. The PCR primers required are shorter than would be required using the standard method. It encodes LacZ&alpha;; new BioBricks that have successfully replaced the part will be white on plates containing IPTG and Xgal. Parts created in this way will also be compatible with the BioSandwich assembly protocol. We proved this part worked by using it to create several other BioBricks.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523006 BBa_K523006]: Plac + malS'''<br />
: ''malS'' is a <span class="hardword" id="periplasm">periplasmic</span> ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found evidence of <span class="hardword" id="starch">starch</span> degrading activity.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: Plac + INP-EYFP'''<br />
: A fusion of Ice Nucleation Protein and Enhanced Yellow Fluorescent Protein under the control of the Lac promoter. Fluoresces yellow under blue light. May be localised to the outer membrane.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523014 BBa_K523014]: Plac + bglX'''<br />
: ''bglX'' is a <span class="hardword" id="cryptic">cryptic</span> &beta;-glucosidase gene from ''E. coli''. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found it to be capable of degrading the <span class="hardword" id="cellobiose">cellobiose</span> analog, MUG.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523025 BBa_K523025]: Plac + cxnA'''<br />
: ''cxnA'' is a fusion we constructed (in line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal), containing an exoglucanase and an endoglucanse; it was found to have the functions of both enzymes.<br />
<br />
==Other BioBricks analysed==<br />
<br />
(More details of this are found at the dedicated [[Team:Edinburgh/Collaboration | Collaboration]] page. The information has also been added to the parts' "Experience" sections.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K118022:Experience BBa_K118022]: ''C. fimi'' exoglucanase'''<br />
: At the same time as we tested ''bglX'' for activity, we also tested this old part's ability to degrade the cellobiose analog MUG (weak ability) and the cellulose analog MUC (strong ability).<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K415151:Experience BBa_K415151]: p8-GR1'''<br />
: Supposed to encode a fusion of the pVIII protein to a GR1 zipper. It actually encodes part of the ''E. coli'' aminopeptidase N gene.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K392008:Experience BBa_K392008]: ''C. fimi'' &beta;-glucosidase'''<br />
: We discovered that this part almost certainly starts its coding sequence at the second ATG present, not the first. This is highly relevant information for anyone trying to tune its expression via use of custom Ribosome Binding Sites.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K265008:Experience BBa_K265008]: Ice Nucleation Protein'''<br />
: We successfully used this part, fusing it to Enhanced Yellow Fluorescent Protein, which was apparently transported to the outer membrane as a result.<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/DataTeam:Edinburgh/Data2011-10-28T12:23:14Z<p>Allancrossman: /* Favourite BioBricks */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab','lab_data');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Data Overview</p> <!-- see https://igem.org/Sample_Data_Page for example page. --><br />
<br />
This page provides an overview of the purely biological aspects of our feasibility study, and links to the relevant Parts Registry pages.<br />
<br />
==Cell Surface Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Cell Display | Cell Surface Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them at high copy number on the cell's outer membrane. <span class="hardword" id="inp">Ice Nucleation Protein</span> is used as a carrier for display of the enzymes; it carries them to the outer membrane.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Cell-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''INP&mdash;Endoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523011 BBa_K523011])<br><br />
&nbsp; &nbsp; an '''INP&mdash;&beta;-glucosidase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523004 BBa_K523004])<br><br />
&nbsp; &nbsp; an '''INP&mdash;Exoglucanase''' fusion ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008] + [http://partsregistry.org/Part:BBa_K523009 BBa_K523009])<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals.<br><br><br />
Cellulose degradation is shown at the bottom. In reality, tens of thousands of enzymes will cover the outer membrane in random places.<br><br>A test system to prove that [http://partsregistry.org/Part:BBa_K523008 BBa_K523008] can be used to carry proteins to the outer membrane uses a fusion of INP to '''Yellow Fluorescent Protein (YFP)''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Shown that INP ([http://partsregistry.org/Part:BBa_K523008 BBa_K523008], based on [http://partsregistry.org/Part:BBa_K265008 BBa_K265008]) can be used to carry proteins to the cell membrane, by constructing [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
* Made and tested a new &beta;-glucosidase ''(bglX)'' BioBrick, [http://partsregistry.org/Part:BBa_K523002 BBa_K523002].<br />
* Made ''bglX'' into a format compatible with our BioSandwich assembly protocol ([http://partsregistry.org/Part:BBa_K523004 BBa_K523004]).<br />
* Made new versions of other cellulases, in a format compatible with the BioSandwich protocol.<br />
* Tested an old exoglucanase gene, [http://partsregistry.org/Part:BBa_K118022 BBa_K118022].<br />
* Made fusions of INP to ''bglX'' (&beta;-glucosidase) and ''cex'' (exoglucanase).<br />
<br />
==Phage Display System==<br />
<br />
(Further details are at the dedicated [[Team:Edinburgh/Phage Display | Phage Display]] page.)<br />
<br />
This system aims at achieving synergy between the enzymes by displaying them on an <span class="hardword" id="m13">M13</span> <span class="hardword" id="phage">phage</span>. The major coat protein <span class="hardword" id="p8">pVIII</span> is used as a carrier for display of the enzymes; it incorporates them into the phage.<br />
<br />
===Schematic diagram===<br />
<br />
[[Image:Edinburgh-Data-Phage-Display.png|thumb|center|710px|<br>The completed system should contain:<br><br />
&nbsp; A '''promoter''' ([http://partsregistry.org/Part:BBa_K523000 BBa_K523000]) controlling:<br><br />
&nbsp; &nbsp; an '''Endoglucanase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; a '''&beta;-glucosidase&mdash;pVIII''' fusion<br><br />
&nbsp; &nbsp; an '''Exoglucanase&mdash;pVIII''' fusion<br><br><br />
'''Ribosome Binding Sites''' are indicated as green ovals. '''"Signal"''' means a periplasmic signal sequence, directing the protein to the periplasm to be assembled into the phage.<br><br>A test system uses a fusion of pVIII to ''E. coli'' amylase '''MalS''' instead.]]<br />
<br />
===Progress===<br />
<br />
We have:<br />
<br />
* Made and tested a new amylase ''(malS)'' BioBrick, [http://partsregistry.org/Part:BBa_K523001 BBa_K523001].<br />
* Attempted to fuse it to the major coat protein pVIII.<br />
<br />
==BioSandwich==<br />
<br />
[[Team:Edinburgh/BioSandwich | BioSandwich]] ([[:File:RFC81.pdf|RFC 81]]) is a new assembly protocol that we used.<br />
<br />
Parts made using BioSandwich that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
==Favourite BioBricks==<br />
<br />
(A complete list of parts made during the project is found at the dedicated [[Team:Edinburgh/Parts | Parts]] page.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523000 BBa_K523000]: Plac + lacZ; with BglII site'''<br />
: Intended as a cloning vector (when present in pSB1C3), this part allows Blue/White selection of newly PCR'ed BioBricks. The PCR primers required are shorter than would be required using the standard method. It encodes LacZ&alpha;; new BioBricks that have successfully replaced the part will be white on plates containing IPTG and Xgal. Parts created in this way will also be compatible with the BioSandwich assembly protocol. We proved this part worked by using it to create several other BioBricks.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523006 BBa_K523006]: Plac + malS'''<br />
: ''malS'' is a <span class="hardword" id="periplasm">periplasmic</span> ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found evidence of <span class="hardword" id="starch">starch</span> degrading activity.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: Plac + INP-EYFP'''<br />
: A fusion of Ice Nucleation Protein and Enhanced Yellow Fluorescent Protein under the control of the Lac promoter. Fluoresces yellow under blue light. May be localised to the outer membrane.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523014 BBa_K523014]: Plac + bglX'''<br />
: ''bglX'' is a <span class="hardword" id="cryptic">cryptic</span> &beta;-glucosidase gene from ''E. coli''. It ought to be usable for a fusion to INP or pVIII. But to test its normal activity, we placed it under the control of the lac promoter in a high copy number plasmid. We found it to be capable of degrading the <span class="hardword" id="cellobiose">cellobiose</span> analog, MUG.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K523025 BBa_K523025]: Plac + cxnA'''<br />
: ''cxnA'' is a fusion we constructed (in line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal), containing an exoglucanase and an endoglucanse; it was found to have the functions of both enzymes.<br />
<br />
==Other BioBricks analysed==<br />
<br />
(More details of this are found at the dedicated [[Team:Edinburgh/Collaboration | Collaboration]] page. The information has also been added to the parts' "Experience" sections.)<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K118022:Experience BBa_K118022]: ''C. fimi'' exoglucanase'''<br />
: At the same time as we tested ''bglX'' for activity, we also tested this old part's ability to degrade the cellobiose analog MUG (weak ability) and the cellulose analog MUC (strong ability).<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K415151:Experience BBa_K415151]: p8-GR1'''<br />
: Supposed to encode a fusion of the pVIII protein to a GR1 zipper. It actually encodes part of the ''E. coli'' aminopeptidase N gene.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K392008:Experience BBa_K392008]: ''C. fimi'' &beta;-glucosidase'''<br />
: We discovered that this part almost certainly starts its coding sequence at the second ATG present, not the first. This is highly relevant information for anyone trying to tune its expression via use of custom Ribosome Binding Sites.<br />
<br />
; '''[http://partsregistry.org/Part:BBa_K265008:Experience BBa_K265008]: Ice Nucleation Protein'''<br />
: We successfully used this part, fusing it to Enhanced Yellow Fluorescent Protein, which was apparently transported to the outer membrane as a result.<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Cell_DisplayTeam:Edinburgh/Cell Display2011-10-28T12:23:02Z<p>Allancrossman: /* An alternative: protein chains */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('home', 'home_cell');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Cell Surface Display: Proposals</p><br />
<br />
The first proposed system our feasibility study will examine, while searching for a way to keep extracellular enzymes close together, is based on displaying proteins at high density on an <span class="hardword" id="ec">''E. coli''</span> outer membrane. This type of display is called "cell surface display".<br />
<br />
We will attempt to design such a system for <span class="hardword" id="cellulase">cellulases</span>, and see if we can get it to work.<br />
<br />
==Outline==<br />
<br />
In order to get a normal enzyme displayed on the ''E. coli'' outer membrane, the enzyme must be fused to a carrier protein; that is, one which is naturally transported to the outer membrane.<br />
<br />
[https://2009.igem.org/Team:Berkeley_Wetlab/Assay_Protocols Berkeley 2009] tried several different carrier proteins with several different passenger enzymes, and had success in many areas. However, when they tried attaching cellulases, they [https://2009.igem.org/Team:Berkeley_Wetlab/Passenger:_Cellulases weren't so successful] - of the two quantified cellulases, one worked just as well without the carrier (Cel5b) and the other didn't work (Cel9a, as compared to negative control).<br />
<br />
We will try a different carrier. The <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K265008 BBa_K265008] made by [https://2009.igem.org/Team:UC_Davis UC Davis 2009] is a synthetic, codon-optimised sequence, based on [http://www.ncbi.nlm.nih.gov/nuccore/AF013159 GenBank AF013159] and coding for the first 211 and last 97 amino acids of <span class="hardword" id="inp">Ice Nucleation Protein</span> (INP, normally coded by the ''inaK'' gene) from the bacterium <span class="hardword" id="ps">Pseudomonas syringae</span>. It seems promising as a carrier of enzymes. Fusions are carried out at the INP C terminal.<br />
<br />
[[File:Three-displays.png|thumb|center|600px|Three strategies for INP-based cell display. After [http://www.sciencedirect.com/science/article/pii/S016777991000199X Van Bloois ''et al'' (2011)]]]<br />
<br />
[http://www.sciencedirect.com/science/article/pii/S016777991000199X Van Bloois ''et al'' (2011)] speak highly of INP, and claim that it can be displayed at a copy number of around 100,000 copies per cell without affecting viability.<br />
<br />
INP has major domains at its N and C terminals, as well as a number of internal repeating domains. There seem to be three strategies for using INP (see figure):<br />
<br />
* Use the entire INP protein; fuse at its C terminal<br />
* Delete the INP internal domains; fuse at its C terminal<br />
* Delete all of INP except the N domain; fuse at the new C terminal<br />
<br />
[http://partsregistry.org/Part:BBa_K265008 BBa_K265008] should be suitable for the 2nd strategy.<br />
<br />
===Linkers===<br />
<br />
It is probably desirable to create <span class="hardword" id="linker">linkers</span> between the carrier and the protein of interest, to give the proteins space to fold. The new assembly protocol that we are investigating &mdash; [[Team:Edinburgh/BioSandwich|BioSandwich]] &mdash; should be ideal for this.<br />
<br />
===Complete system===<br />
<br />
The complete 3 cellulase system could contain a promoter, driving expression of three coding fusions:<br />
<br />
* INP -- (Linker) -- endoglucanase (e.g. [http://partsregistry.org/Part:BBa_K392006 BBa_K392006])<br />
* INP -- (Linker) -- exoglucanase (e.g. [http://partsregistry.org/Part:BBa_K392007 BBa_K392007])<br />
* INP -- (Linker) -- &beta;-glucosidase (e.g. [http://partsregistry.org/Part:BBa_K392008 BBa_K392008])<br />
<br />
===An alternative: protein chains===<br />
<br />
[[File:INP-chain.png|thumb|center|600px|The protein chain idea: a long fusion protein is created with INP fused to (say) 3 enzymes in a row...]]<br />
<br />
Instead of making three different fusions, it might be possible to make one fusion that had all three cellulase enzymes linked together; we call this "beads on a string". As it happens, the exoglucanase (Cex) and the endoglucanase (CenA) both have a cellulose-binding module (CBM), but they are at different ends of the sequence. So here's the plan:<br />
<br />
* Create a fusion of:<br />
** '''Exoglucanase''' (catalytic domain) -- '''CBM''' -- '''Endoglucanase''' (catalytic domain)<br />
** This can be done by homology or by introducing an NcoI site into both Exo- and Endoglucanase at the appropriate locations, then ligating and doing fusion PCR.<br />
* We can then use KpnI in a similar way to attach a '''&beta;-glucosidase''' at either end.<br />
* Then attach INP.<br />
<br />
==Genetic instability==<br />
<br />
In order to display several different proteins on one bacterium using the first strategy, it will be necessary to have several copies of the INP gene fused to different enzymes. The presence of repeated sequences on a plasmid can lead to genetic instability.<br />
<br />
This will not be a problem in the JM109 lab strain, which lacks an important <span class="hardword" id="recombination">recombination</span> enzyme. As for the use of this technology in industry, it will be possible to overcome this problem simply by synthesising coding sequences with as many altered (but <span class="hardword" id="synonymouscodon">synonymous</span>) codons as possible. We have written a software tool for designing such sequences... see the [[Team:Edinburgh/Genetic instability|genetic instability]] page.<br />
<br />
==Proof of concept: YFP==<br />
<br />
As far as we know, nobody has used [http://partsregistry.org/Part:BBa_K265008 BBa_K265008] for cell display. We could prove that it works by simply displaying the Yellow Fluorescent Protein on INP. Indeed, something similar was achieved by [http://www.postech.edu/~hjcha/INP-N-GFP-OPH.pdf Li ''et al'' (2004)] and [http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.2009.01724.x/abstract Li ''et al'' (2009)] for a different version of the gene.<br />
<br />
==Results==<br />
<br />
Please see the team's [[Team:Edinburgh/Data | Data Page]] for information about how far we got with this project.<br />
<br />
==References==<br />
<br />
* Li L, Kang DG, Cha HJ (2004) [http://www.postech.edu/~hjcha/INP-N-GFP-OPH.pdf Functional display of foreign protein on surface of ''Escherichia coli'' using N-terminal domain of Ice Nucleation Protein]. ''Biotechnology and Bioengineering'' '''85'''(2): 214-221 (doi: 10.1002/bit.10892).<br />
<br />
* Li Q, Yu Z, Shao X, He J, Li L (2009) [http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.2009.01724.x/abstract Improved phosphate biosorption by bacterial surface display of phosphate-binding protein utilizing ice nucleation protein]. ''FEMS Microbiology Letters'' '''299'''(1): 44-52 (doi: 10.1111/j.1574-6968.2009.01724.x).<br />
<br />
* Van Bloois E, Winter RT, Kolmar H, Fraaije MW (2011) [http://www.sciencedirect.com/science/article/pii/S016777991000199X Decorating microbes: surface display of proteins on ''Escherichia coli'']. ''Trends in Biotechnology'' '''29'''(2): 79-86 (doi: 10.1016/j.tibtech.2010.11.003).<br />
<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-28T12:17:27Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of <span class="hardoword" id="cellobiose">cellobiose</span>.<br />
<br />
We tested the ability of ''E. coli'' with this ''bglX'' part to grow on minimal media with cellobiose as the only carbon source. It could not. By contrast, it did grow if glucose was the carbon source, showing that it is fundamentally capable of growing on minimal media:<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:K523014 on cellobiose.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:K523014 glucose control.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|Cellobiose as the only carbon source. K523014 (bottom) fails to grow.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|Glucose as the only carbon source. K523014 can grow.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==''cxnA''==<br />
<br />
In line with our [[Team:Edinburgh/Cell_Display#An_alternative:_protein_chains|beads on a string]] proposal, We created a fusion of ''cex'' and ''cenA''. This showed the activity of both enzymes:<br />
<br />
* Cex activity was tested on MUC plates.<br />
* CenA activity was tested on CMC plates.<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523025 BBa_K523025].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/User_talk:L.KopecUser talk:L.Kopec2011-10-27T17:16:19Z<p>Allancrossman: </p>
<hr />
<div>Hola. I edited a bunch of stuff e.g. to add more pages to the list of links.<br />
<br />
Oh, also, hints are not being cleared when the user mouses-over a new hint... [[User:Allancrossman|Allancrossman]] 11:48, 17 July 2011 (CDT)<br />
<br />
Oh also also, the contents box of [[Team:Edinburgh/Assembly]] is messed up for some reason. [[User:Allancrossman|Allancrossman]] 04:17, 18 July 2011 (CDT)<br />
<br />
<br />
Hmm, in the contents box at [[Team:Edinburgh/Assembly]] the major headings 2, 4 and 5 are off to the right in the box, both for me at home and on this machine in the honours room... [[User:Allancrossman|Allancrossman]] 07:02, 18 July 2011 (CDT)<br />
<br />
<br />
Also also also, would you object strenuously if we just used default fonts? I've tested it and it looks fabulous, the h3 works much better, and it doesn't have problems with machines (like mine at home) that have anti-aliasing turned off.... [[User:Allancrossman|Allancrossman]] 08:21, 18 July 2011 (CDT)<br />
<br />
<br />
It seems the Genetic Algorithm is just superior to the others in many ways; I wonder if it's even worth mentioning the others? [[User:Allancrossman|Allancrossman]] 15:19, 20 July 2011 (CDT)<br />
<br />
----<br />
<br />
As we discussed from time to time, I folded the sponsors page into Home and made a Practices thing in the main menu. You should probably check if my edits to [[Team:Edinburgh/tech/Navbox]] and [[Team:Edinburgh/tech/colours]] are completely correct... [[User:Allancrossman|Allancrossman]] 17:57, 28 July 2011 (CDT)<br />
<br />
----<br />
<br />
I went to Twitch Gaming and took a screenshot on IE9, this is what it looked like:<br />
<br />
[[:File:Twitch-IE9-SS.jpg]]<br />
<br />
Note some issues in the left menu... [[User:Allancrossman|Allancrossman]] 12:33, 1 September 2011 (CDT)<br />
<br />
----<br />
<br />
It's a bit grim isn't it? [[User:Allancrossman|Allancrossman]] 16:54, 11 September 2011 (CDT)<br />
<br />
----<br />
<br />
I'm beginning to suspect that it's actually any attempt to access [[:File:Edinburgh-spatial-syn.gif]] that triggers the wiki to freeze... maybe assume it's corrupted and upload it to a new location, or something? [[User:Allancrossman|Allancrossman]] 09:32, 13 September 2011 (CDT)<br />
<br />
<br />
By the way, the arrows on the [https://2011.igem.org/Team:Edinburgh/Kappa_Animation animation page] don't really make sense, especially in their current position. [[User:Allancrossman|Allancrossman]] 14:51, 14 September 2011 (CDT)<br />
<br />
Also:<br />
<br />
: "A graph showing the total yield of a system in 16 hours of simulation time while cellulose is added to the system at certain cellulose levels"<br />
<br />
The highest bar is for "Cellulose: 10%" - but actually stuff is added when cellulose is at 90%, right? [[User:Allancrossman|Allancrossman]] 17:15, 14 September 2011 (CDT)<br />
<br />
----<br />
<br />
I reuploaded the broken GIF, it seems to work now - check [[Team:Edinburgh/Kappa_Animation]] - is it OK? [[User:Allancrossman|Allancrossman]] 18:13, 15 September 2011 (CDT)<br />
<br />
Actually I take it back - it still hangs if you go to the image description. I've reverted. The image description page did give an interesting error message when I uploaded it, which now I can't see... [[User:Allancrossman|Allancrossman]] 18:18, 15 September 2011 (CDT)<br />
<br />
----<br />
<br />
I'd recommend removing the sitemap, just so you can move the hints box higher up... [[User:Allancrossman|Allancrossman]] 06:45, 18 September 2011 (CDT)<br />
<br />
----<br />
<br />
Managed to get [[Team:Edinburgh/Kappa_Animation]] using local images. [[User:Allancrossman|Allancrossman]] 16:19, 11 October 2011 (CDT)<br />
<br />
----<br />
<br />
"this is hardly the time to be conjugating temporal verbs in the past impossible never tense!"</div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-27T16:46:14Z<p>Allancrossman: /* bglX and cex */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of <span class="hardoword" id="cellobiose">cellobiose</span>.<br />
<br />
We tested the ability of ''E. coli'' with this ''bglX'' part to grow on minimal media with cellobiose as the only carbon source. It could not. By contrast, it did grow if glucose was the carbon source, showing that it is fundamentally capable of growing on minimal media:<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:K523014 on cellobiose.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:K523014 glucose control.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|Cellobiose as the only carbon source. K523014 (bottom) fails to grow.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|Glucose as the only carbon source. K523014 can grow.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-27T16:45:10Z<p>Allancrossman: /* bglX and cex */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of cellobiose.<br />
<br />
We tested the ability of ''E. coli'' with this part to grow on minimal media with cellobiose as the only carbon source. It could not. By contrast, it did grow if glucose was the carbon source, showing that it is fundamentally capable of growing on minimal media:<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:K523014 on cellobiose.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:K523014 glucose control.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|Cellobiose as the only carbon source. K523014 (bottom) fails to grow.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|Glucose as the only carbon source. K523014 can grow.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-27T16:44:57Z<p>Allancrossman: /* bglX and cex */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of cellobiose.<br />
<br />
We tested the ability of ''E. coli'' with this part to grow on minimal media with cellobiose as the only carbon source. It could not. By contrast, it did grow if glucose was the carbon source, showing that it is fundamentally capable of growing on minimal media.<br />
<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:K523014 on cellobiose.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:K523014 glucose control.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|Cellobiose as the only carbon source. K523014 (bottom) fails to grow.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|Glucose as the only carbon source. K523014 can grow.<br />
|}<br />
</center><br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/File:K523014_on_cellobiose.jpgFile:K523014 on cellobiose.jpg2011-10-27T16:44:12Z<p>Allancrossman: </p>
<hr />
<div></div>Allancrossmanhttp://2011.igem.org/File:K523014_glucose_control.jpgFile:K523014 glucose control.jpg2011-10-27T16:44:00Z<p>Allancrossman: </p>
<hr />
<div></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-27T16:43:43Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Experiments</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of cellobiose. For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/ExperimentsTeam:Edinburgh/Experiments2011-10-27T16:30:02Z<p>Allancrossman: /* malS */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('lab', 'lab_results');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Results</p><br />
<br />
Actual results of experiments are placed here, but '''more detailed discussions are also found on the relevant Registry pages.'''<br />
<br />
==''malS''==<br />
<br />
We placed ''malS'' (an ''E. coli'' <span class="hardword" id="amylase">amylase</span> gene) under the control of the lac <span class="hardword" id="promoter">promoter</span> and grew the cells on <span class="hardword" id="starch">starch</span> agar. An iodine-based <span class="hardword" id="assay">assay</span> was carried out testing for starch degradation.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
| [[Image:523001-assay-pre2.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post.jpg|200px]]<br />
| &nbsp; &nbsp;<br />
| [[Image:523001-assay-post-post2.jpg|200px]]<br />
|-<br />
| width="200px" valign="top" | Before the assay. Colony 1 failed to grow. '''Control at top.'''<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | Immediately after iodine flooding.<br />
| &nbsp; &nbsp;<br />
| width="200px" valign="top" | 40 minutes after iodine flooding.<br />
|}<br />
</center><br />
<br />
We also conducted an assay based on cell extract's ability to degrade starch, producing glucose that would react with 3,5-dinitrosalicylic acid.<br />
<br />
<br />
[[File:Edinburgh_K523006-DNS-Assay.png|700px|center]]<br />
<br />
<br />
Finally, we tested the ability of bacteria with overexpression of ''malS'' to grow on a starch agar with no other carbon source. Indeed it could, while normal ''E. coli'' cannot:<br />
<br />
<br />
[[File:K523006_on_starch.jpg|400px|center]]<br />
<br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523006 BBa_K523006].<br />
<br />
==''bglX'' and ''cex''==<br />
<br />
We placed ''bglX'' (a <span class="hardword" id="cryptic">cryptic</span> ''E. coli'' &beta;-glucosidase gene) under the control of the lac promoter and compared its activity to the exoglucanase ''cex''.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:BglX-MuG.jpg|300px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:Cex-MuC.jpg|300px]]<br />
|-<br />
|width="300px" valign="top"|'''MUG assay.''' ''bglX'' on left, ''cex'' on right.<br />
|&nbsp; &nbsp;<br />
|width="300px" valign="top"|'''MUC assay.''' ''bglX'' on left, ''cex'' on right.<br />
|}<br />
</center><br />
<br />
''bglX'' was capable of degrading the substrate MUG, which has a &beta;(1&rarr;4) bond, similar to that of cellobiose. For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==INP-EYFP==<br />
<br />
We made a fusion ([http://partsregistry.org/Part:BBa_K523013 BBa_K523013]) of <span class="hardword" id="inp">Ice Nucleation Protein</span> and Enhanced Yellow Fluorescent Protein, and placed it under the control of the Lac promoter.<br />
<br />
Under blue light, the cells fluoresced yellow, as shown below (left image). Unfortunately, our imaging technology was not capable of showing whether the fluorescence was localised to the outer membrane, so we centrifuged the cells so that the membrane fraction was localised to the bottom of the tube and compared the result to a colony expressing EYFP without INP. This showed that the INP-EYFP was indeed localised to the cell membrane.<br />
<br />
<center><br />
{| style="margin-top: 1em; margin-bottom: 1em;"<br />
|-<br />
|[[Image:Edinburgh-INP-YFP-cells.jpg|147px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged.jpg|200px]]<br />
|&nbsp; &nbsp;<br />
|[[Image:523013-centrifuged-auto-white.jpg|200px]]<br />
|-<br />
|width="147px" valign="top" | Cells fluorescing yellow.<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | Centrifuged cells. Control on left. '''INP-EYFP on right.'''<br />
|&nbsp; &nbsp;<br />
|width="200px" valign="top" | The same image passed through GIMP's auto white balance filter.<br />
|}<br />
</center><br />
<br />
For more information, see the Registry page on [http://partsregistry.org/Part:BBa_K523013 BBa_K523013].<br />
<br />
==BioSandwich==<br />
<br />
The BioSandwich system is outlined on [[Team:Edinburgh/BioSandwich|its own page]]. BioSandwich creates parts with <span class="hardword" id="homology">homologous</span> ends, but there are a number of ways in which the final assembly could be carried out. Throughout the project we mostly used Gibson Assembly.<br />
<br />
===Parts made with BioSandwich===<br />
<br />
Parts that we believe are correct (subject to final verification sequencing) include:<br />
<br />
* [http://partsregistry.org/Part:BBa_K523013 BBa_K523013]: PlacLacZ-INP-YFP<br />
* [http://partsregistry.org/Part:BBa_K523019 BBa_K523019]: PlacLacZ-INP-cex ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523020 BBa_K523020]: PlacLacZ-INP-bglX ['''update:''' sequencing shows this part has errors]<br />
* [http://partsregistry.org/Part:BBa_K523022 BBa_K523022]: PlacLacZ-crtEIB<br />
<br />
===Extensive tests - what can go wrong?===<br />
<br />
We also tested a number of final assembly methods, by attempting to join a <span class="hardword" id="promoter">promoter</span> and LacZ construct to a Yellow Fluorescent coding sequence, making [http://partsregistry.org/Part:BBa_K523023 BBa_K523023]. This part will produce a <span class="hardword" id="polycistronic">polycistronic</span> RNA transcript, coding for proteins that turn the bacteria blue (on Xgal) but also make it fluoresce yellow.<br />
<br />
BioSandwich inserts short spacers between each part to be assembled. Note that after spacer2 we expect to see some extra bases before we reach the RFC10 suffix, because of the choice of vector. We can call these extra bases the "stuffing". So, the expected sequence is:<br />
<br />
: '''Vector -- spacerT7 -- Plac,LacZ -- spacer1 -- EYFP -- spacer2 -- stuffing'''<br />
<br />
Successful assemblies are expected to generate blue colonies that fluoresce yellow under a blue light. We tried several assembly methods, all of which generated many colonies with the correct phenotype, but also many colonies with an incorrect phenotype...<br />
<br />
From each plate we sequenced a colony with the correct phenotype (if there were any) and some colonies with incorrect phenotypes, in an attempt to understand what the failure modes were.<br />
<br />
====BioSandwich with Gibson Assembly====<br />
<br />
Like, OEPCR, this method produces many correct colonies and many incorrect colonies.<br />
<br />
The Gibson method was described by [http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Gibson ''et al'' (2009)]. A gentle introduction was written by the 2010 Cambridge iGEM team, and is found [https://2010.igem.org/Team:Cambridge/Gibson/Introduction here].<br />
<br />
We sequenced a colony with the correct phenotype, as well as others with incorrect phenotypes:<br />
<br />
* '''Colony "gby" [blue, yellow]''' - expected scar is missing at approx base 680 of the forward chromatogram. Also, the spacer ends with ATG and the part starts with ATG, but only one ATG is seen. In total 9 bases are missing. There is homology of "tatgg" at both ends of the deleted fragment. There is a point mutation at approx base 500 of the forward chromatogram.<br />
* '''Colony "gb" [blue]''' - there is a deletion of about 80 bases at approx base 700 of the chromatogram. This has been caused by homology of a "gggcgagg" found at both ends of the deleted sequence. The 9 bases mentioned for '''gby''' are also missing.<br />
* '''Colony "gwy" [yellow]''' - seems correct except for a point mutation in the reverse chromatogram. The mutation is synonymous (ctg -> ttg). There's no clear reason why the colony wasn't blue.<br />
<br />
Lessons learned: bits of homology, even quite small, can cause problems with this method.<br />
<br />
====BioSandwich with Overlap Extension PCR====<br />
<br />
Overlap Extension PCR can be performed using spoligos as primers. The extension time should be calculated from the entire product size. The final product will not be circular, so can be run on a gel to test its length. Later, it will need to have its ends ligated.<br />
<br />
This method produces many correct colonies, although it also produces many incorrect colonies.<br />
<br />
[For our tests, different primers were used and spacer2 was not needed.]<br />
<br />
* '''Colony "bby" [blue, yellow]''' - correct sequence.<br />
* '''Colony "bb" [blue]''' - has a massive deletion (several hundred bases) in the EYFP gene after about 60 bases. There is partial homology between the start and end of the deletion: "tggtcgagctggac" vs "tggacgagctgtac".<br />
* '''Colony "bw" [plain]''' - has spacerT7 joined to spacer1, and the same massive deletion as '''bb'''.<br />
<br />
Again homology seems to be an issue. Parts joining randomly (in bw) is worrying.<br />
<br />
====BioSandwich with Ligation Independent Cloning====<br />
<br />
In our experience, this method has been only weakly successful. We have seen one correct colony in several attempts.<br />
<br />
To attempt the LIC method, simply mix the parts and vector (4 uL of each). Heat a beaker of water to 95 C, and float the reaction tube in it, and allow everything to cool. Afterwards, it may now be necessary to centrifuge the tube briefly to move the liquid back to the bottom.<br />
<br />
* '''Colony "b1" [blue, yellow]''' - sequence read is of low quality but things seem correct.<br />
* '''Colony "y2" [yellow]''' - appears to simply be [http://partsregistry.org/Part:BBa_K216011 BBa_K216011], the template for the initial PCR<br />
* '''Colony "n4" [plain]''' - sequence is unreadable.<br />
<br />
The y2 colony is probably expressing a template for PCR which made it all the way through the various steps that came afterwards.<br />
<br />
====BioSandwich with Blunt-End Ligation Independent Cloning====<br />
<br />
This is expected to fail as Ligation Independent Cloning requires long overhangs at the end of each part, not blunt ends. No correct colonies were seen.<br />
<br />
* '''Colony "bb1" [blue]''' - seems to be [http://partsregistry.org/Part:BBa_J33207 BBa_J33207] followed by part of ''E. coli'' ferrous iron transport gene A.<br />
* '''Colony "bw2" [plain]''' - has spacerT7 followed by the stuffing.<br />
* '''Colony "bw3" [plain]''' - has RFC10 prefix followed by RFC10 suffix, as if XbaI and SpeI sites have joined in a normal vector.<br />
<br />
====BioSandwich with CPEC: Circular Polymerase Extension Cloning====<br />
<br />
* '''Colony "cby" [blue, yellow]''' - there is a single-base deletion near the start of the PlacLacZ part, with no obvious cause. It is too early to affect expression. The last few bases of spacer1 are missing, as well as the first few bases of the EYFP part (9 bases total). This is explained by homology of "tatgg". Otherwise seems correct.<br />
* '''Colony "cb" [blue]''' - Normal until the end of spacer1, which is followed immediately by spacer2 and the stuffing.<br />
* '''Colony "cw" [plain]''' - spacerT7 is followed immediately by a second copy of spacerT7, after which comes spacer2 and a second copy of spacer2. Then the stuffing.<br />
<br />
This gave some of the weirder results.<br />
<br />
===Semi-quantitative results===<br />
<br />
Our lab supervisor Chris French recorded the results of some early BioSandwich assembly attempts. Since correct assemblies of the construct described above (PlacLacZ-EYFP) should produce blue colonies that fluoresce yellow under blue light, we can get a rough idea of how many colonies are correct by counting phenotypes.<br />
<br />
; BioSandwich with OEPCR<br />
: Assembly produced around 100 colonies on a 100 microlitre plate, about half of these blue, and most of the blue also yellow.<br />
; BioSandwich with Gibson<br />
: Assembly produced about 100-200 colonies on a 100 microlitre plate, about half blue and half white, and the blue ones about 75% yellow.<br />
; BioSandwich with CPEC<br />
: Assembly produced 60 colonies, of which 26 were blue, of which half were also yellow.<br />
<br />
===Various assemblies===<br />
<br />
The core team made a number of constructs with PlacLacZ plus other genes. While these other genes usually did not give an easily spotted phenotype, we can at least see how many of them were blue on Xgal.<br />
<br />
As an explanation, "100 plate" and "900 plate" refer to the concentration of transformed cells plated.<br />
<br />
; '''BioSandwich with OEPCR'''<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 1 white+yellow<br />
:: 900 plate> 1 blue, 7 white+yellow, 1 white<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 188 white, 7 blue<br />
:: 900 plate> 165 blue, 376 white<br />
<br />
; '''BioSandwich with Gibson'''<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 46 white, 3 blue<br />
:: 900 plate> 929 white, 48 blue<br />
: pSB1C3-PlacLacZ-INP-cex '''(should be blue)'''<br />
:: 100 plate> 38 white, 2 blue, 1 red<br />
:: 900 plate> 633 white, 61 blue, 2 red<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 57 white<br />
:: 900 plate> 575 white, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX '''(should be blue)'''<br />
:: 100 plate> 54 white, 16 blue<br />
:: 900 plate> 423 white, 156 blue<br />
: pSB1C3-PlacLacZ-crtEIB '''(should be blue, or maybe red)'''<br />
:: 100 plate> 2 white<br />
:: 900 plate> 1 blue, 80 white<br />
: pSB1C3-PlacLacZ-INP-malS '''(should be blue)'''<br />
:: 100 plate> 16 blue, 74 white<br />
<br />
; '''BioSandwich with CPEC'''<br />
: pSB1C3-PlacLacZ-crtEIB --- 7 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 31 white, 19 blue<br />
:: 900 plate> 257 white, 149 blue<br />
: pSB1C3-PlacLacZ-crtEIB --- 3 cycles '''(should be blue, or maybe red)'''<br />
:: 100 plate> 1 white<br />
:: 900 plate> 15 white, 4 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---7 cycles '''(should be blue)'''<br />
:: 100 plate> 21 white<br />
:: 900 plate> 363 white, 1 red, 1 blue<br />
: pSB1C3-PlacLacZ-INP-bglX ---3 cycles '''(should be blue)'''<br />
:: 100 plate> 75 white, 4 blue<br />
:: 900 plate> 494 white, 36 blue, 2 red.<br />
: pSB1C3-PlacLacZ-INP-YFP '''(should be blue and yellow)'''<br />
:: 100 plate> 15 white<br />
:: 900 plate> 74 white, 1 blue+yellow<br />
: pSB1C3-PlacLacZ-INP-MalS '''(should be blue)'''<br />
:: 100 plate> 6 white, 4 blue<br />
:: 900 plate> 32 blue, 127 white<br />
<br />
It seems our supervisor with his 15 years postdoctoral experience had slightly better results than we did. Hmm...<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/File:K523006_on_starch.jpgFile:K523006 on starch.jpg2011-10-27T16:27:38Z<p>Allancrossman: </p>
<hr />
<div></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/PracticesTeam:Edinburgh/Practices2011-10-26T15:13:01Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_humanpractices');<br />
}); </script></html><br />
<div class="main_body"><br />
<!--<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
WARNING: This page is linked to from the Judging Form, at: https://igem.org/2011_Judging_Form?id=523<br />
Please think carefully before editing. This is the main launch point for Practices judges.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
--><p class="h1">Human Practices</p><br />
<br />
==The need for questions==<br />
<br />
The field of Synthetic Biology is relatively new, and so its long-term implications are the subject of debate.<br />
<br />
How will Synthetic Biology impact our environment, how we source our food, and society in general? And is Synthetic Biology a genuine solution to a problem, or just a solution in search of a problem?<br />
<br />
If our project is to have both credibility and longevity it is important that we ask these questions. The answers may challenge us, but this process is necessary if we are to deepen our understanding and advance the field. With that in mind, we have chosen to conduct our whole project as a feasibility study, not only into the biology, but also into the design, economics, and social implications of industrial plants making use of that biology.<br />
<br />
===Biorefineries: design and economics===<br />
<br />
The biological side of our project is based on the degradation of cellulose &mdash; an abundant, recalcitrant material &mdash; and converting it into useful products. This would occur in a "biorefinery".<br />
<br />
It is not enough to simply show that the biology can work. The project must also be economically viable, and a practical design for a biorefinery must be created. For this, see the [[Team:Edinburgh/Biorefinery | Biorefinery]] page.<br />
<br />
===Biorefineries: life cycle analysis===<br />
<br />
We attempted an environmental analysis of biorefineries, using the technique of [[Team:Edinburgh/Life Cycle Analysis|Life Cycle Analysis]] to follow the fate of everything that interacts with the biorefinery.<br />
<br />
===Biorefineries: social implications===<br />
<br />
The broader social implications of the project must be considered. We have made contact with and interviewed a number of different figures from various fields: environmentalism, business, academia, politics, and the Church. All of these people are involved, one way or another, in the debate surrounding Synthetic Biology. For this, see:<br />
<br />
* [[Team:Edinburgh/Interviews_(Overview) | Interviews: Overview]]<br />
* [[Team:Edinburgh/Interviews | Interviews]]<br />
* [[Team:Edinburgh/Interview_Analysis | Interview Analysis]]<br />
<br />
==Edinburgh and the iGEM Community==<br />
<br />
An altogether different society is the Synthetic Biology community, and we have naturally interacted with other members of it.<br />
<br />
Early on, we created our [[Team:Edinburgh/Wiki Watch | Wiki Watch]] page, which we hope has been of assistance to other teams looking to collaborate on similar projects. Later, we collaborated with another team debugging and assaying a BioBrick. We also helped update the Registry with information on previous years' parts. See the [[Team:Edinburgh/Collaboration | Collaboration]] page.<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Life_Cycle_AnalysisTeam:Edinburgh/Life Cycle Analysis2011-10-26T15:09:21Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_lifecycle');<br />
}); </script></html><br />
<div class="main_body"><br />
<p class="h1">Life Cycle Analysis</p><br />
==Aims==<br />
<br />
If in the future <span class="hardword" id="biorefinery">biorefineries</span> become prevalent in the way we source our food and energy, <span class="hardword" id="cellulose">cellulose</span> is likely to play a significant role. The Edinburgh team’s biology work attempts to make strides in how to effectively harness cellulose’s potential. If it proves that enzymes working in <span class="hardword" id="synergy">synergy</span> can degrade more cellulose than the ''status quo'', then the impact is effectively large, as a 1% increased efficiency in the lab would be significant on an industrial scale. <br />
<br />
The implications of such a project or any other advance in this technology could mean that more biorefineries are built, continuing the growth in this industry. Edinburgh’s human practices work is concerned about understanding the implications of this technology for society. In other sections we ask what the technology would look like, whether it is feasible and what the economic implications are. But what of the effects on the environment? In this section a life cycle analysis is carried out which aims to identify possible environmental concerns. The analysis will follow the path of waste paper from its origins, then into the biorefinery process and afterwards. While many life-cycle analyses look directly into the impact of carbon numerically, this analysis is purely qualitative. <br />
<br />
==Graphical analysis==<br />
[[File:Edinburgh-life-cycle-analysis.png|thumb|center|600px|Life cycle analysis]]<br />
<br />
==Analysis==<br />
<br />
<br />
*Paper waste is used as the primary raw material in the biorefinery. In the status quo is paper is recycled to make more paper. However a certain percentage is turned into waste. Is it possible to take that percentage and use it in the biorefinery? The composition of cellulose is the determining factor which would need to be examined. If the raw materials were made up of pure biomass then the implications to the environment would be proportionally greater. Therefore locally sourced biomass, which does not impact on agricultural land, is the preferred option. <br />
<br />
*Currently the biorefinery is an energy and chemically intensive process. The amounts needed to convert 700 kg/h of raw materials into glucose is substantial. But, as outlined in the biorefinery design section, synthetic biology may hold the answers to a reduction in energy required (i.e. using a recombinant enzyme for the conversion of lignin into phenols bypassing the energy intensive hydrous pyrolysis).<br />
<br />
*A method used widely in Scandinavia is using excess heat from the plant and transferring it to local communities. This would mean the biorefinery would have to be situated close to a populous town/city which could have implications of its own. <br />
<br />
*By converting waste paper to sorbitol and then to toothpaste, the biorefinery which uses synthetic biology prolongs the life of paper. Toothpaste tubes can then be recycled into plastics.<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/tech/NavboxTeam:Edinburgh/tech/Navbox2011-10-22T09:33:12Z<p>Allancrossman: </p>
<hr />
<div><!-- start content --><br />
<html><link rel='stylesheet' type='text/css' href='/Team:Edinburgh/tech/basiccss?action=raw&amp;ctype=text/css' /><br />
<link rel='stylesheet' type='text/css' href='/Team:Edinburgh/tech/colours?action=raw&amp;ctype=text/css' /><br />
<!--[if IE]><br />
<link rel='stylesheet' type='text/css' href='/Team:Edinburgh/tech/iefixes?action=raw&amp;ctype=text/css' /><br />
<![endif]--><br />
<script type="text/javascript" src="/Team:Edinburgh/tech/js?action=raw&amp;ctype=text/javascript"></script><br />
<div class="tops"><br />
<a href="/Team:Edinburgh"><div class="logo"><br />
<!-- FIXME to /wiki/images/2/25/Edinburgh-logo.png --><br />
</div></a> <!-- /logo --><br />
<div class="mainmenu"><br />
<ul><br />
<li><a href="/Team:Edinburgh" class="home">outline</a></li><br />
<li><a href="/Team:Edinburgh/Modelling" class="model">in silico</a></li><br />
<li><a href="/Team:Edinburgh/Data" class="lab">in the lab</a></li><br />
<li><a href="/Team:Edinburgh/Practices" class="practices">in society</a></li><br />
<li><a href="/Team:Edinburgh/Conclusions" class="team">postscript</a></li><br />
</ul><br />
</div> <!-- /mainmenu --><br />
</div> <!-- /tops --><br />
<div class="mids"><br />
<div id="sidebar"><br />
<div class="leftmenu" id="homemenu"><br />
<ul><br />
<li><a href="/Team:Edinburgh" class="home_abstract">abstract</a></li><br />
<li><a href="/Team:Edinburgh/Safety" class="home_safety">safety</a></li><br />
<li><a href="/Team:Edinburgh/Cell_Display" class="home_cell">cell surface display</a></li><br />
<li><a href="/Team:Edinburgh/Phage_Display" class="home_phage">phage display</a></li><br />
<li><a href="/Team:Edinburgh/Achievements" class="home_achievements">achievements</a></li><br />
</ul><br />
</div><!-- /leftmenu --><br />
<br />
<div class="leftmenu" id="modelmenu"><br />
<ul><br />
<li><a href="/Team:Edinburgh/Modelling" class="model_modelling">modelling</a></li><br />
<li><a href="/Team:Edinburgh/Cellulases (C model)" class="model_synergyc">cellulases (C)</a></li><br />
<li><a href="/Team:Edinburgh/Cellulases (Kappa model)" class="model_synergykappa">cellulases (Kappa)</a></li><br />
<li><a href="/Team:Edinburgh/Cellulases (MATLAB model)" class="model_synergymatlab">cellulases (MATLAB)</a></li><br />
<li><a href="/Team:Edinburgh/Model Comparison" class="model_comparison">model comparison</a></li><br />
<li><a href="/Team:Edinburgh/Genetic_Instability" class="model_genetic_instability">genetic instability</a></li><br />
<li><a href="/Team:Edinburgh/Efficiency" class="model_efficiency">efficiency</a></li><br />
<li><a href="/Team:Edinburgh/Artificial_Selection" class="model_artificial_selection">artificial selection</a></li><br />
<li><a href="/Team:Edinburgh/Phage Replication" class="model_phagerep">phage replication</a></li><br />
</ul><br />
</div> <!-- /leftmenu --><br />
<br />
<div class="leftmenu" id="labmenu"><br />
<ul><br />
<li><a href="/Team:Edinburgh/Data" class="lab_data">data overview</a></li><br />
<li><a href="/Team:Edinburgh/Experiments" class="lab_results">experiments</a></li><br />
<li><a href="/Team:Edinburgh/Parts" class="lab_parts">parts</a></li><br />
<li><a href="/Team:Edinburgh/BioSandwich" class="lab_biosandwich">BioSandwich</a></li><br />
<li><a href="/Team:Edinburgh/Lab_Notebook" class="lab_notebook">lab notebook</a></li><br />
</ul><br />
</div> <!-- /leftmenu --><br />
<br />
<div class="leftmenu" id="teammenu"><br />
<ul><br />
<li><a href="/Team:Edinburgh/Conclusions" class="team_conclusions">conclusions</a></li><br />
<li><a href="/Team:Edinburgh/Team" class="team_people">the team</a></li><br />
<li><a href="/Team:Edinburgh/Attributions" class="team_attributions">attributions</a></li><br />
<li><a href="/Team:Edinburgh/Sponsors" class="team_our_sponsors">our sponsors</a></li><br />
</ul><br />
</div> <!-- /leftmenu --><br />
<br />
<div class="leftmenu" id="practicesmenu"><br />
<ul><br />
<li><a href="/Team:Edinburgh/Practices" class="practices_humanpractices">human practices</a></li><br />
<li><a href="/Team:Edinburgh/Biorefinery" class="practices_biorefinery">biorefinery design</a></li><br />
<li><a href="/Team:Edinburgh/Biorefinery_Appendices" class="practices_appendices">biorefinery appendices</a></li><br />
<li><a href="/Team:Edinburgh/Life_Cycle_Analysis" class="practices_lifecycle">life cycle analysis</a></li><br />
<li><a href="/Team:Edinburgh/Interviews (Overview)" class="practices_overview">interviews: overview</a></li><br />
<li><a href="/Team:Edinburgh/Interviews" class="practices_interviews">interviews</a></li><br />
<li><a href="/Team:Edinburgh/Interview_Analysis" class="practices_analysis">interview analysis</a></li><br />
<li><a href="/Team:Edinburgh/Collaboration" class="practices_synbio">collaboration</a></li><br />
<li><a href="/Team:Edinburgh/Wiki_Watch" class="practices_wiki_watch">wiki watch</a></li><br />
</ul><br />
</div> <!-- /leftmenu --><br />
<div id="hintcontainer"><br />
<div class="hint" id="def_hint">Hover over words in <i><b>bold italics</b></i> to see explanation.</div><br />
</div> <!-- /hints --><br />
</div> <!-- /sidebar --><br />
<!-- end nav+logo --><br />
</html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Life_Cycle_AnalysisTeam:Edinburgh/Life Cycle Analysis2011-10-22T09:32:52Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_lifecycle');<br />
}); </script></html><br />
<div class="main_body"><br />
<p class="h1">Life Cycle Analysis</p><br />
Ditto.<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Life_cycle_analysisTeam:Edinburgh/Life cycle analysis2011-10-22T09:32:39Z<p>Allancrossman: moved Team:Edinburgh/Life cycle analysis to Team:Edinburgh/Life Cycle Analysis</p>
<hr />
<div>#REDIRECT [[Team:Edinburgh/Life Cycle Analysis]]</div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Life_Cycle_AnalysisTeam:Edinburgh/Life Cycle Analysis2011-10-22T09:32:39Z<p>Allancrossman: moved Team:Edinburgh/Life cycle analysis to Team:Edinburgh/Life Cycle Analysis</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_lifecycle');<br />
}); </script></html><br />
<div class="main_body"><br />
<p class="h1">Life cycle analysis</p><br />
Ditto.<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/CollaborationTeam:Edinburgh/Collaboration2011-10-19T19:48:47Z<p>Allancrossman: /* Thanks to ETH Zurich */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_synbio');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Collaboration with the Synbio Community</p><br />
<br />
<span class="hardword" id="igem">iGEM</span> teams have always been a highly visible part of the synthetic biology community, and an important part of iGEM is contributing to that community. Thus, the relationship between our project and the projects of other teams, past and present, is of the highest importance.<br />
<br />
==Thanks to UC Davis and KU Leuven==<br />
<br />
We gratefully acknowledge UC Davis 2009, who synthesised an ''E. coli'' optimised version of <span class="hardword" id="inp">Ice Nucleation Protein</span>, originally from the organism <span class="hardword" id="ps">Pseudomonas syringae</span>. We were delighted to discover that the part we received from the Registry had the correct sequence.<br />
<br />
We also acknowledge the help of this year's KU Leuven team, whose project involved Ice Nucleation Protein, and who sent us plasmid pUC1813ICE containing the ''inaZ'' version of the gene.<br />
<br />
==Thanks to ETH Zurich==<br />
<br />
After we presented ''(inter alia)'' our modelling at the European Jamboree, the team from ETH Zurich contacted us with some helpful bugfixes in one of our models &mdash; the [[Team:Edinburgh/Cellulases (MATLAB model)|MATLAB cellulase model]] &mdash; which we had some trouble with. If time permits, these will be implemented and tested.<br />
<br />
==Cooperation with Trieste==<br />
<br />
Like us, Trieste's team this year are using the <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K392008 BBa_K392008]. This part by Osaka 2010 encodes a <span class="hardword" id="cellulase">cellulase</span>, &beta;-glucosidase, from the bacterium ''Cellulomonas fimi''. It is known to work in the lab of Chris French (Edinburgh's supervisor).<br />
<br />
Chris French sent Trieste a copy of the plasmid, however they reported some sequence errors and asked us for comments. We sequenced the gene independently and discovered that an apparent <span class="hardword" id="frameshift">frameshift</span> is present near the start of the BioBrick. This very same "frameshift" was seen in Trieste's sequencing results.<br />
<br />
Since a part with an early frameshift cannot possibly work, but the part does work, we looked for an explanation. Some 220 bases into the part, a second ATG codon is found. This codon is in-frame and there is a plausible <span class="hardword" id="rbs">ribosome binding site</span> (containing "gaagga") just upstream of it. We therefore believe that this second ATG is the true start codon. The RBS would explain why the part can be expressed and work.<br />
<br />
Here is the start of the sequence, with these features highlighted:<br />
<br />
<div style="margin-left: 4em;"><br />
<code><br />
'''&gt; BBa_K392008 Part-only sequence (1671 bp)'''<br><br />
atgggcgaccggttccagcaggccggtcgcccacgccgccgcggcccggcgagggccgtt<br><br />
aaccgtaccggtcaagaagacgcgtcgacggggtcgagggagcggtcccacgcgtgtatc<br><br />
gtatcgtttcgacaccgccacccggccaccgggcacgcaccggggacgcagcagtccccg<br><br />
ccccggccaccccctgtcaccgaaaccc<font color="blue">'''gaagga'''</font>ccctc<font color="red">'''atg'''</font>accaccacgcgcccctcg<br><br />
[rest omitted]<br />
</code><br />
</div><br />
<br />
In agreement with this hypothesis, a [http://www.ncbi.nlm.nih.gov/nuccore/332337569?from=3105074&to=3106528 recently published sequence] of ''C. fimi'' &beta;-glucosidase (labelled as such by [http://enzyme.expasy.org/EC/3.2.1.21 Expasy] though NCBI calls it a &beta;-galactosidase) starts at the 2nd ATG codon of K392008. This is in contrast to an [http://www.ncbi.nlm.nih.gov/nuccore/304358?from=18&to=1688 older published sequence].<br />
<br />
We passed this information on to the Trieste team, who agreed that it is a likely explanation.<br />
<br />
In addition to this, at the request of the Trieste team we sent details of an assay that can be used to test for activity of this &beta;-glucosidase. This assay involves 4-methylumbelliferyl-&beta;-D-glucuronide, which is cleaved by &beta;-glucosidase to yield a fluorescent product visible under long-wave blue light. We used this assay ourselves for [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==Wiki Watch==<br />
<br />
We created a [[Team:Edinburgh/Wiki Watch | Wiki Watch]] page that attempted to convey the very basics of what every other team in the competition was doing. Early in the summer, this page was linked from the official iGEM [[Community]] page, and we hope it has helped other teams find partners for cooperation.<br />
<br />
==Updating the Registry==<br />
<br />
The hub of our community's collective experience is the Parts Registry. During our work, we have discovered some useful information about several parts in the Registry. We have entered this information in the "experience" section of the relevant pages.<br />
<br />
===[http://partsregistry.org/Part:BBa_K118022 BBa_K118022]===<br />
<br />
This part by Edinburgh 2008 encodes an exoglucanase, capable of degrading <span class="hardword" id="cellulose">cellulose</span>. We tested its ability to degrade the cellulose analog MUC, and found that it could.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118022:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K415151 BBa_K415151]===<br />
<br />
This part by MIT 2010 is supposed to encode a <span class="hardword" id="fusion">fusion</span> of the <span class="hardword" id="p8">pVIII</span> protein to a GR1 zipper. However, we noticed that the official verification sequencing carried out by the Registry did not match the expected sequence and did not contain a prefix or suffix.<br />
<br />
We tried to determine what the sequence actually is, and discovered that it is [http://www.ncbi.nlm.nih.gov/nuccore/48994873?from=989379&to=991367&report=gbwithparts a fragment] of the ''E. coli'' main genome. This fragment naturally has EcoRI and PstI sites at its ends. It has evidently been cut with those enzymes and has somehow become inserted into pSB1C3 via those sites. This naturally wipes out the XbaI and SpeI sites, explaining their absence.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K415151:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K392008 BBa_K392008]===<br />
<br />
As mentioned above, Trieste and Edinburgh cooperated around the use of this part from Osaka 2010, and came to suspect that the second ATG present in the sequence is the real start codon.<br />
<br />
In addition, there are some other discrepancies between the published sequence and the physical K392008 as well.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K392008:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K265008 BBa_K265008]===<br />
<br />
This is the synthetic Ice Nucleation Protein from UC Davis 2009. We updated the relevant [http://partsregistry.org/Part:BBa_K265008:Experience experience page] to mention our successful use of it.<br />
<br />
===[http://partsregistry.org/Part:BBa_J33207 BBa_J33207]===<br />
<br />
This part encodes LacZ&alpha;, and provides a cunning way to make new BioBricks using shorter PCR primers than normal, by incorporating a SacI site. We made a new version deleting about 50 unnecessary bases and based on a different restriction site.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_J33207:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K118023 BBa_K118023]===<br />
<br />
This part was made by Edinburgh 2008. When we sequenced it, we found a discrepancy between the physical DNA and the Registry sequence. We checked against a published genome sequence and found that the Registry sequence is incorrect.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118023:Experience experience page].<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/CollaborationTeam:Edinburgh/Collaboration2011-10-19T12:48:17Z<p>Allancrossman: /* Thanks to ETH Zurich */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_synbio');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Collaboration with the Synbio Community</p><br />
<br />
<span class="hardword" id="igem">iGEM</span> teams have always been a highly visible part of the synthetic biology community, and an important part of iGEM is contributing to that community. Thus, the relationship between our project and the projects of other teams, past and present, is of the highest importance.<br />
<br />
==Thanks to UC Davis and KU Leuven==<br />
<br />
We gratefully acknowledge UC Davis 2009, who synthesised an ''E. coli'' optimised version of <span class="hardword" id="inp">Ice Nucleation Protein</span>, originally from the organism <span class="hardword" id="ps">Pseudomonas syringae</span>. We were delighted to discover that the part we received from the Registry had the correct sequence.<br />
<br />
We also acknowledge the help of this year's KU Leuven team, whose project involved Ice Nucleation Protein, and who sent us plasmid pUC1813ICE containing the ''inaZ'' version of the gene.<br />
<br />
==Thanks to ETH Zurich==<br />
<br />
After we presented ''(inter alia)'' our modelling at the European Jamboree, the team from ETH Zurich contacted us with some helpful bugfixes in one of our models &mdash; the [[Team:Edinburgh/Cellulases (MATLAB model)|MATLAB model]] &mdash; which we had some trouble with. If time permits, these will be implemented and tested.<br />
<br />
==Cooperation with Trieste==<br />
<br />
Like us, Trieste's team this year are using the <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K392008 BBa_K392008]. This part by Osaka 2010 encodes a <span class="hardword" id="cellulase">cellulase</span>, &beta;-glucosidase, from the bacterium ''Cellulomonas fimi''. It is known to work in the lab of Chris French (Edinburgh's supervisor).<br />
<br />
Chris French sent Trieste a copy of the plasmid, however they reported some sequence errors and asked us for comments. We sequenced the gene independently and discovered that an apparent <span class="hardword" id="frameshift">frameshift</span> is present near the start of the BioBrick. This very same "frameshift" was seen in Trieste's sequencing results.<br />
<br />
Since a part with an early frameshift cannot possibly work, but the part does work, we looked for an explanation. Some 220 bases into the part, a second ATG codon is found. This codon is in-frame and there is a plausible <span class="hardword" id="rbs">ribosome binding site</span> (containing "gaagga") just upstream of it. We therefore believe that this second ATG is the true start codon. The RBS would explain why the part can be expressed and work.<br />
<br />
Here is the start of the sequence, with these features highlighted:<br />
<br />
<div style="margin-left: 4em;"><br />
<code><br />
'''&gt; BBa_K392008 Part-only sequence (1671 bp)'''<br><br />
atgggcgaccggttccagcaggccggtcgcccacgccgccgcggcccggcgagggccgtt<br><br />
aaccgtaccggtcaagaagacgcgtcgacggggtcgagggagcggtcccacgcgtgtatc<br><br />
gtatcgtttcgacaccgccacccggccaccgggcacgcaccggggacgcagcagtccccg<br><br />
ccccggccaccccctgtcaccgaaaccc<font color="blue">'''gaagga'''</font>ccctc<font color="red">'''atg'''</font>accaccacgcgcccctcg<br><br />
[rest omitted]<br />
</code><br />
</div><br />
<br />
In agreement with this hypothesis, a [http://www.ncbi.nlm.nih.gov/nuccore/332337569?from=3105074&to=3106528 recently published sequence] of ''C. fimi'' &beta;-glucosidase (labelled as such by [http://enzyme.expasy.org/EC/3.2.1.21 Expasy] though NCBI calls it a &beta;-galactosidase) starts at the 2nd ATG codon of K392008. This is in contrast to an [http://www.ncbi.nlm.nih.gov/nuccore/304358?from=18&to=1688 older published sequence].<br />
<br />
We passed this information on to the Trieste team, who agreed that it is a likely explanation.<br />
<br />
In addition to this, at the request of the Trieste team we sent details of an assay that can be used to test for activity of this &beta;-glucosidase. This assay involves 4-methylumbelliferyl-&beta;-D-glucuronide, which is cleaved by &beta;-glucosidase to yield a fluorescent product visible under long-wave blue light. We used this assay ourselves for [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==Wiki Watch==<br />
<br />
We created a [[Team:Edinburgh/Wiki Watch | Wiki Watch]] page that attempted to convey the very basics of what every other team in the competition was doing. Early in the summer, this page was linked from the official iGEM [[Community]] page, and we hope it has helped other teams find partners for cooperation.<br />
<br />
==Updating the Registry==<br />
<br />
The hub of our community's collective experience is the Parts Registry. During our work, we have discovered some useful information about several parts in the Registry. We have entered this information in the "experience" section of the relevant pages.<br />
<br />
===[http://partsregistry.org/Part:BBa_K118022 BBa_K118022]===<br />
<br />
This part by Edinburgh 2008 encodes an exoglucanase, capable of degrading <span class="hardword" id="cellulose">cellulose</span>. We tested its ability to degrade the cellulose analog MUC, and found that it could.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118022:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K415151 BBa_K415151]===<br />
<br />
This part by MIT 2010 is supposed to encode a <span class="hardword" id="fusion">fusion</span> of the <span class="hardword" id="p8">pVIII</span> protein to a GR1 zipper. However, we noticed that the official verification sequencing carried out by the Registry did not match the expected sequence and did not contain a prefix or suffix.<br />
<br />
We tried to determine what the sequence actually is, and discovered that it is [http://www.ncbi.nlm.nih.gov/nuccore/48994873?from=989379&to=991367&report=gbwithparts a fragment] of the ''E. coli'' main genome. This fragment naturally has EcoRI and PstI sites at its ends. It has evidently been cut with those enzymes and has somehow become inserted into pSB1C3 via those sites. This naturally wipes out the XbaI and SpeI sites, explaining their absence.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K415151:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K392008 BBa_K392008]===<br />
<br />
As mentioned above, Trieste and Edinburgh cooperated around the use of this part from Osaka 2010, and came to suspect that the second ATG present in the sequence is the real start codon.<br />
<br />
In addition, there are some other discrepancies between the published sequence and the physical K392008 as well.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K392008:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K265008 BBa_K265008]===<br />
<br />
This is the synthetic Ice Nucleation Protein from UC Davis 2009. We updated the relevant [http://partsregistry.org/Part:BBa_K265008:Experience experience page] to mention our successful use of it.<br />
<br />
===[http://partsregistry.org/Part:BBa_J33207 BBa_J33207]===<br />
<br />
This part encodes LacZ&alpha;, and provides a cunning way to make new BioBricks using shorter PCR primers than normal, by incorporating a SacI site. We made a new version deleting about 50 unnecessary bases and based on a different restriction site.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_J33207:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K118023 BBa_K118023]===<br />
<br />
This part was made by Edinburgh 2008. When we sequenced it, we found a discrepancy between the physical DNA and the Registry sequence. We checked against a published genome sequence and found that the Registry sequence is incorrect.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118023:Experience experience page].<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/CollaborationTeam:Edinburgh/Collaboration2011-10-19T12:37:49Z<p>Allancrossman: /* Thanks to ETH Zurich */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_synbio');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Collaboration with the Synbio Community</p><br />
<br />
<span class="hardword" id="igem">iGEM</span> teams have always been a highly visible part of the synthetic biology community, and an important part of iGEM is contributing to that community. Thus, the relationship between our project and the projects of other teams, past and present, is of the highest importance.<br />
<br />
==Thanks to UC Davis and KU Leuven==<br />
<br />
We gratefully acknowledge UC Davis 2009, who synthesised an ''E. coli'' optimised version of <span class="hardword" id="inp">Ice Nucleation Protein</span>, originally from the organism <span class="hardword" id="ps">Pseudomonas syringae</span>. We were delighted to discover that the part we received from the Registry had the correct sequence.<br />
<br />
We also acknowledge the help of this year's KU Leuven team, whose project involved Ice Nucleation Protein, and who sent us plasmid pUC1813ICE containing the ''inaZ'' version of the gene.<br />
<br />
==Thanks to ETH Zurich==<br />
<br />
After we presented ''(inter alia)'' our modelling at the European Jamboree, the team from ETH Zurich contacted us with some helpful bugfixes in one of our models &mdash; the [[Team:Edinburgh/Cellulases (MATLAB model)|MATLAB model]] &mdash; which we had some trouble with. These will be implemented and tested if time permits.<br />
<br />
==Cooperation with Trieste==<br />
<br />
Like us, Trieste's team this year are using the <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K392008 BBa_K392008]. This part by Osaka 2010 encodes a <span class="hardword" id="cellulase">cellulase</span>, &beta;-glucosidase, from the bacterium ''Cellulomonas fimi''. It is known to work in the lab of Chris French (Edinburgh's supervisor).<br />
<br />
Chris French sent Trieste a copy of the plasmid, however they reported some sequence errors and asked us for comments. We sequenced the gene independently and discovered that an apparent <span class="hardword" id="frameshift">frameshift</span> is present near the start of the BioBrick. This very same "frameshift" was seen in Trieste's sequencing results.<br />
<br />
Since a part with an early frameshift cannot possibly work, but the part does work, we looked for an explanation. Some 220 bases into the part, a second ATG codon is found. This codon is in-frame and there is a plausible <span class="hardword" id="rbs">ribosome binding site</span> (containing "gaagga") just upstream of it. We therefore believe that this second ATG is the true start codon. The RBS would explain why the part can be expressed and work.<br />
<br />
Here is the start of the sequence, with these features highlighted:<br />
<br />
<div style="margin-left: 4em;"><br />
<code><br />
'''&gt; BBa_K392008 Part-only sequence (1671 bp)'''<br><br />
atgggcgaccggttccagcaggccggtcgcccacgccgccgcggcccggcgagggccgtt<br><br />
aaccgtaccggtcaagaagacgcgtcgacggggtcgagggagcggtcccacgcgtgtatc<br><br />
gtatcgtttcgacaccgccacccggccaccgggcacgcaccggggacgcagcagtccccg<br><br />
ccccggccaccccctgtcaccgaaaccc<font color="blue">'''gaagga'''</font>ccctc<font color="red">'''atg'''</font>accaccacgcgcccctcg<br><br />
[rest omitted]<br />
</code><br />
</div><br />
<br />
In agreement with this hypothesis, a [http://www.ncbi.nlm.nih.gov/nuccore/332337569?from=3105074&to=3106528 recently published sequence] of ''C. fimi'' &beta;-glucosidase (labelled as such by [http://enzyme.expasy.org/EC/3.2.1.21 Expasy] though NCBI calls it a &beta;-galactosidase) starts at the 2nd ATG codon of K392008. This is in contrast to an [http://www.ncbi.nlm.nih.gov/nuccore/304358?from=18&to=1688 older published sequence].<br />
<br />
We passed this information on to the Trieste team, who agreed that it is a likely explanation.<br />
<br />
In addition to this, at the request of the Trieste team we sent details of an assay that can be used to test for activity of this &beta;-glucosidase. This assay involves 4-methylumbelliferyl-&beta;-D-glucuronide, which is cleaved by &beta;-glucosidase to yield a fluorescent product visible under long-wave blue light. We used this assay ourselves for [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==Wiki Watch==<br />
<br />
We created a [[Team:Edinburgh/Wiki Watch | Wiki Watch]] page that attempted to convey the very basics of what every other team in the competition was doing. Early in the summer, this page was linked from the official iGEM [[Community]] page, and we hope it has helped other teams find partners for cooperation.<br />
<br />
==Updating the Registry==<br />
<br />
The hub of our community's collective experience is the Parts Registry. During our work, we have discovered some useful information about several parts in the Registry. We have entered this information in the "experience" section of the relevant pages.<br />
<br />
===[http://partsregistry.org/Part:BBa_K118022 BBa_K118022]===<br />
<br />
This part by Edinburgh 2008 encodes an exoglucanase, capable of degrading <span class="hardword" id="cellulose">cellulose</span>. We tested its ability to degrade the cellulose analog MUC, and found that it could.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118022:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K415151 BBa_K415151]===<br />
<br />
This part by MIT 2010 is supposed to encode a <span class="hardword" id="fusion">fusion</span> of the <span class="hardword" id="p8">pVIII</span> protein to a GR1 zipper. However, we noticed that the official verification sequencing carried out by the Registry did not match the expected sequence and did not contain a prefix or suffix.<br />
<br />
We tried to determine what the sequence actually is, and discovered that it is [http://www.ncbi.nlm.nih.gov/nuccore/48994873?from=989379&to=991367&report=gbwithparts a fragment] of the ''E. coli'' main genome. This fragment naturally has EcoRI and PstI sites at its ends. It has evidently been cut with those enzymes and has somehow become inserted into pSB1C3 via those sites. This naturally wipes out the XbaI and SpeI sites, explaining their absence.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K415151:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K392008 BBa_K392008]===<br />
<br />
As mentioned above, Trieste and Edinburgh cooperated around the use of this part from Osaka 2010, and came to suspect that the second ATG present in the sequence is the real start codon.<br />
<br />
In addition, there are some other discrepancies between the published sequence and the physical K392008 as well.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K392008:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K265008 BBa_K265008]===<br />
<br />
This is the synthetic Ice Nucleation Protein from UC Davis 2009. We updated the relevant [http://partsregistry.org/Part:BBa_K265008:Experience experience page] to mention our successful use of it.<br />
<br />
===[http://partsregistry.org/Part:BBa_J33207 BBa_J33207]===<br />
<br />
This part encodes LacZ&alpha;, and provides a cunning way to make new BioBricks using shorter PCR primers than normal, by incorporating a SacI site. We made a new version deleting about 50 unnecessary bases and based on a different restriction site.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_J33207:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K118023 BBa_K118023]===<br />
<br />
This part was made by Edinburgh 2008. When we sequenced it, we found a discrepancy between the physical DNA and the Registry sequence. We checked against a published genome sequence and found that the Registry sequence is incorrect.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118023:Experience experience page].<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/CollaborationTeam:Edinburgh/Collaboration2011-10-19T12:34:02Z<p>Allancrossman: /* Thanks to ETH Zurich */</p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_synbio');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Collaboration with the Synbio Community</p><br />
<br />
<span class="hardword" id="igem">iGEM</span> teams have always been a highly visible part of the synthetic biology community, and an important part of iGEM is contributing to that community. Thus, the relationship between our project and the projects of other teams, past and present, is of the highest importance.<br />
<br />
==Thanks to UC Davis and KU Leuven==<br />
<br />
We gratefully acknowledge UC Davis 2009, who synthesised an ''E. coli'' optimised version of <span class="hardword" id="inp">Ice Nucleation Protein</span>, originally from the organism <span class="hardword" id="ps">Pseudomonas syringae</span>. We were delighted to discover that the part we received from the Registry had the correct sequence.<br />
<br />
We also acknowledge the help of this year's KU Leuven team, whose project involved Ice Nucleation Protein, and who sent us plasmid pUC1813ICE containing the ''inaZ'' version of the gene.<br />
<br />
==Thanks to ETH Zurich==<br />
<br />
After we presented ''(inter alia)'' our modelling at the European Jamboree, the team from ETH Zurich contacted us with some helpful bugfixes in one of our models &mdash; the [[Team:Edinburgh/Cellulases (MATLAB model)|MATLAB model]] &mdash; which we had some trouble with.<br />
<br />
==Cooperation with Trieste==<br />
<br />
Like us, Trieste's team this year are using the <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K392008 BBa_K392008]. This part by Osaka 2010 encodes a <span class="hardword" id="cellulase">cellulase</span>, &beta;-glucosidase, from the bacterium ''Cellulomonas fimi''. It is known to work in the lab of Chris French (Edinburgh's supervisor).<br />
<br />
Chris French sent Trieste a copy of the plasmid, however they reported some sequence errors and asked us for comments. We sequenced the gene independently and discovered that an apparent <span class="hardword" id="frameshift">frameshift</span> is present near the start of the BioBrick. This very same "frameshift" was seen in Trieste's sequencing results.<br />
<br />
Since a part with an early frameshift cannot possibly work, but the part does work, we looked for an explanation. Some 220 bases into the part, a second ATG codon is found. This codon is in-frame and there is a plausible <span class="hardword" id="rbs">ribosome binding site</span> (containing "gaagga") just upstream of it. We therefore believe that this second ATG is the true start codon. The RBS would explain why the part can be expressed and work.<br />
<br />
Here is the start of the sequence, with these features highlighted:<br />
<br />
<div style="margin-left: 4em;"><br />
<code><br />
'''&gt; BBa_K392008 Part-only sequence (1671 bp)'''<br><br />
atgggcgaccggttccagcaggccggtcgcccacgccgccgcggcccggcgagggccgtt<br><br />
aaccgtaccggtcaagaagacgcgtcgacggggtcgagggagcggtcccacgcgtgtatc<br><br />
gtatcgtttcgacaccgccacccggccaccgggcacgcaccggggacgcagcagtccccg<br><br />
ccccggccaccccctgtcaccgaaaccc<font color="blue">'''gaagga'''</font>ccctc<font color="red">'''atg'''</font>accaccacgcgcccctcg<br><br />
[rest omitted]<br />
</code><br />
</div><br />
<br />
In agreement with this hypothesis, a [http://www.ncbi.nlm.nih.gov/nuccore/332337569?from=3105074&to=3106528 recently published sequence] of ''C. fimi'' &beta;-glucosidase (labelled as such by [http://enzyme.expasy.org/EC/3.2.1.21 Expasy] though NCBI calls it a &beta;-galactosidase) starts at the 2nd ATG codon of K392008. This is in contrast to an [http://www.ncbi.nlm.nih.gov/nuccore/304358?from=18&to=1688 older published sequence].<br />
<br />
We passed this information on to the Trieste team, who agreed that it is a likely explanation.<br />
<br />
In addition to this, at the request of the Trieste team we sent details of an assay that can be used to test for activity of this &beta;-glucosidase. This assay involves 4-methylumbelliferyl-&beta;-D-glucuronide, which is cleaved by &beta;-glucosidase to yield a fluorescent product visible under long-wave blue light. We used this assay ourselves for [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==Wiki Watch==<br />
<br />
We created a [[Team:Edinburgh/Wiki Watch | Wiki Watch]] page that attempted to convey the very basics of what every other team in the competition was doing. Early in the summer, this page was linked from the official iGEM [[Community]] page, and we hope it has helped other teams find partners for cooperation.<br />
<br />
==Updating the Registry==<br />
<br />
The hub of our community's collective experience is the Parts Registry. During our work, we have discovered some useful information about several parts in the Registry. We have entered this information in the "experience" section of the relevant pages.<br />
<br />
===[http://partsregistry.org/Part:BBa_K118022 BBa_K118022]===<br />
<br />
This part by Edinburgh 2008 encodes an exoglucanase, capable of degrading <span class="hardword" id="cellulose">cellulose</span>. We tested its ability to degrade the cellulose analog MUC, and found that it could.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118022:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K415151 BBa_K415151]===<br />
<br />
This part by MIT 2010 is supposed to encode a <span class="hardword" id="fusion">fusion</span> of the <span class="hardword" id="p8">pVIII</span> protein to a GR1 zipper. However, we noticed that the official verification sequencing carried out by the Registry did not match the expected sequence and did not contain a prefix or suffix.<br />
<br />
We tried to determine what the sequence actually is, and discovered that it is [http://www.ncbi.nlm.nih.gov/nuccore/48994873?from=989379&to=991367&report=gbwithparts a fragment] of the ''E. coli'' main genome. This fragment naturally has EcoRI and PstI sites at its ends. It has evidently been cut with those enzymes and has somehow become inserted into pSB1C3 via those sites. This naturally wipes out the XbaI and SpeI sites, explaining their absence.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K415151:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K392008 BBa_K392008]===<br />
<br />
As mentioned above, Trieste and Edinburgh cooperated around the use of this part from Osaka 2010, and came to suspect that the second ATG present in the sequence is the real start codon.<br />
<br />
In addition, there are some other discrepancies between the published sequence and the physical K392008 as well.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K392008:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K265008 BBa_K265008]===<br />
<br />
This is the synthetic Ice Nucleation Protein from UC Davis 2009. We updated the relevant [http://partsregistry.org/Part:BBa_K265008:Experience experience page] to mention our successful use of it.<br />
<br />
===[http://partsregistry.org/Part:BBa_J33207 BBa_J33207]===<br />
<br />
This part encodes LacZ&alpha;, and provides a cunning way to make new BioBricks using shorter PCR primers than normal, by incorporating a SacI site. We made a new version deleting about 50 unnecessary bases and based on a different restriction site.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_J33207:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K118023 BBa_K118023]===<br />
<br />
This part was made by Edinburgh 2008. When we sequenced it, we found a discrepancy between the physical DNA and the Registry sequence. We checked against a published genome sequence and found that the Registry sequence is incorrect.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118023:Experience experience page].<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/CollaborationTeam:Edinburgh/Collaboration2011-10-19T12:31:56Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices','practices_synbio');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Collaboration with the Synbio Community</p><br />
<br />
<span class="hardword" id="igem">iGEM</span> teams have always been a highly visible part of the synthetic biology community, and an important part of iGEM is contributing to that community. Thus, the relationship between our project and the projects of other teams, past and present, is of the highest importance.<br />
<br />
==Thanks to UC Davis and KU Leuven==<br />
<br />
We gratefully acknowledge UC Davis 2009, who synthesised an ''E. coli'' optimised version of <span class="hardword" id="inp">Ice Nucleation Protein</span>, originally from the organism <span class="hardword" id="ps">Pseudomonas syringae</span>. We were delighted to discover that the part we received from the Registry had the correct sequence.<br />
<br />
We also acknowledge the help of this year's KU Leuven team, whose project involved Ice Nucleation Protein, and who sent us plasmid pUC1813ICE containing the ''inaZ'' version of the gene.<br />
<br />
==Thanks to ETH Zurich==<br />
<br />
After we won the prize for Best Modelling at the European Jamboree, ETH Zurich contacted us with some helpful bugfixes in one of our models &mdash; the [[Cellulases (MATLAB model)|MATLAB model]] &mdash; which we had some trouble with.<br />
<br />
==Cooperation with Trieste==<br />
<br />
Like us, Trieste's team this year are using the <span class="hardword" id="biobrick">BioBrick</span> [http://partsregistry.org/Part:BBa_K392008 BBa_K392008]. This part by Osaka 2010 encodes a <span class="hardword" id="cellulase">cellulase</span>, &beta;-glucosidase, from the bacterium ''Cellulomonas fimi''. It is known to work in the lab of Chris French (Edinburgh's supervisor).<br />
<br />
Chris French sent Trieste a copy of the plasmid, however they reported some sequence errors and asked us for comments. We sequenced the gene independently and discovered that an apparent <span class="hardword" id="frameshift">frameshift</span> is present near the start of the BioBrick. This very same "frameshift" was seen in Trieste's sequencing results.<br />
<br />
Since a part with an early frameshift cannot possibly work, but the part does work, we looked for an explanation. Some 220 bases into the part, a second ATG codon is found. This codon is in-frame and there is a plausible <span class="hardword" id="rbs">ribosome binding site</span> (containing "gaagga") just upstream of it. We therefore believe that this second ATG is the true start codon. The RBS would explain why the part can be expressed and work.<br />
<br />
Here is the start of the sequence, with these features highlighted:<br />
<br />
<div style="margin-left: 4em;"><br />
<code><br />
'''&gt; BBa_K392008 Part-only sequence (1671 bp)'''<br><br />
atgggcgaccggttccagcaggccggtcgcccacgccgccgcggcccggcgagggccgtt<br><br />
aaccgtaccggtcaagaagacgcgtcgacggggtcgagggagcggtcccacgcgtgtatc<br><br />
gtatcgtttcgacaccgccacccggccaccgggcacgcaccggggacgcagcagtccccg<br><br />
ccccggccaccccctgtcaccgaaaccc<font color="blue">'''gaagga'''</font>ccctc<font color="red">'''atg'''</font>accaccacgcgcccctcg<br><br />
[rest omitted]<br />
</code><br />
</div><br />
<br />
In agreement with this hypothesis, a [http://www.ncbi.nlm.nih.gov/nuccore/332337569?from=3105074&to=3106528 recently published sequence] of ''C. fimi'' &beta;-glucosidase (labelled as such by [http://enzyme.expasy.org/EC/3.2.1.21 Expasy] though NCBI calls it a &beta;-galactosidase) starts at the 2nd ATG codon of K392008. This is in contrast to an [http://www.ncbi.nlm.nih.gov/nuccore/304358?from=18&to=1688 older published sequence].<br />
<br />
We passed this information on to the Trieste team, who agreed that it is a likely explanation.<br />
<br />
In addition to this, at the request of the Trieste team we sent details of an assay that can be used to test for activity of this &beta;-glucosidase. This assay involves 4-methylumbelliferyl-&beta;-D-glucuronide, which is cleaved by &beta;-glucosidase to yield a fluorescent product visible under long-wave blue light. We used this assay ourselves for [http://partsregistry.org/Part:BBa_K523014 BBa_K523014].<br />
<br />
==Wiki Watch==<br />
<br />
We created a [[Team:Edinburgh/Wiki Watch | Wiki Watch]] page that attempted to convey the very basics of what every other team in the competition was doing. Early in the summer, this page was linked from the official iGEM [[Community]] page, and we hope it has helped other teams find partners for cooperation.<br />
<br />
==Updating the Registry==<br />
<br />
The hub of our community's collective experience is the Parts Registry. During our work, we have discovered some useful information about several parts in the Registry. We have entered this information in the "experience" section of the relevant pages.<br />
<br />
===[http://partsregistry.org/Part:BBa_K118022 BBa_K118022]===<br />
<br />
This part by Edinburgh 2008 encodes an exoglucanase, capable of degrading <span class="hardword" id="cellulose">cellulose</span>. We tested its ability to degrade the cellulose analog MUC, and found that it could.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118022:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K415151 BBa_K415151]===<br />
<br />
This part by MIT 2010 is supposed to encode a <span class="hardword" id="fusion">fusion</span> of the <span class="hardword" id="p8">pVIII</span> protein to a GR1 zipper. However, we noticed that the official verification sequencing carried out by the Registry did not match the expected sequence and did not contain a prefix or suffix.<br />
<br />
We tried to determine what the sequence actually is, and discovered that it is [http://www.ncbi.nlm.nih.gov/nuccore/48994873?from=989379&to=991367&report=gbwithparts a fragment] of the ''E. coli'' main genome. This fragment naturally has EcoRI and PstI sites at its ends. It has evidently been cut with those enzymes and has somehow become inserted into pSB1C3 via those sites. This naturally wipes out the XbaI and SpeI sites, explaining their absence.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K415151:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K392008 BBa_K392008]===<br />
<br />
As mentioned above, Trieste and Edinburgh cooperated around the use of this part from Osaka 2010, and came to suspect that the second ATG present in the sequence is the real start codon.<br />
<br />
In addition, there are some other discrepancies between the published sequence and the physical K392008 as well.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K392008:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K265008 BBa_K265008]===<br />
<br />
This is the synthetic Ice Nucleation Protein from UC Davis 2009. We updated the relevant [http://partsregistry.org/Part:BBa_K265008:Experience experience page] to mention our successful use of it.<br />
<br />
===[http://partsregistry.org/Part:BBa_J33207 BBa_J33207]===<br />
<br />
This part encodes LacZ&alpha;, and provides a cunning way to make new BioBricks using shorter PCR primers than normal, by incorporating a SacI site. We made a new version deleting about 50 unnecessary bases and based on a different restriction site.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_J33207:Experience experience page].<br />
<br />
===[http://partsregistry.org/Part:BBa_K118023 BBa_K118023]===<br />
<br />
This part was made by Edinburgh 2008. When we sequenced it, we found a discrepancy between the physical DNA and the Registry sequence. We checked against a published genome sequence and found that the Registry sequence is incorrect.<br />
<br />
This information has been added to the Registry on the relevant [http://partsregistry.org/Part:BBa_K118023:Experience experience page].<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossmanhttp://2011.igem.org/Team:Edinburgh/Wiki_WatchTeam:Edinburgh/Wiki Watch2011-10-19T10:50:03Z<p>Allancrossman: </p>
<hr />
<div>{{:Team:Edinburgh/tech/Navbox}}<br />
<html><script type="text/javascript" >$(document).ready(function() {<br />
getMenus('practices', 'practices_wiki_watch');<br />
}); </script></html><br />
<div class="main_body"><br />
<br />
<p class="h1">Wiki Watch</p><br />
<br />
<center>''I carried out my orders until arrested. I had no sense that I was''<br />
<br>''spying, and I ask that this be taken into account in deciding my verdict.''</center><br />
<p style="text-align: center; margin-left: 14em;">&mdash; Witold Pilecki</p><br />
<br />
In order to help collaboration between teams, as well as for our own enlightenment, we put together the following list of projects. This page is now linked from the [[Community]] page, and we hope others have found it useful.<br />
<br />
Descriptions here might be incorrect for teams that switched project in the first few weeks. As of September 9, [[Jamboree/Team Abstracts | full team abstracts are available]].<br />
<br />
High School teams are not shown (unless participating in the main event). Teams that withdrew without making substantive wiki edits have been hidden. Teams that have [https://igem.org/Results?year=2011 advanced] to the finals in MIT are highlighted, along with all non-withdrawn Software Track teams, who are [https://2011.igem.org/Software/Team_Advancement assumed] to advance.<br />
<br />
{| style="font-size: 9pt"<br />
|-<br />
| <span style="font-size: 150%;">'''Americas'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| [[Team:Alberta | Alberta]]<br />
| Converting biomass to biodiesel using ''[http://en.wikipedia.org/wiki/Neurospora_crassa Neurospora crassa]''.<br />
|-<br />
| [[Team:Arizona State | Arizona State]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
|-<br />
| [[Team:Baltimore | Baltimore]]<br />
| Creation of a [http://en.wikipedia.org/wiki/Taq_polymerase Taq polymerase] BioBrick.<br />
|-<br />
| [[Team:Bard-Annandale | Bard-Annandale]]<br />
| Logical construct involving quorum sensing and Lux genes.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Berkeley | Berkeley]]<br />
| style="background-color: #eeffee;" | Stress-repressed promoter in front of stress-producing (toxic) product to regulate its level.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:British Columbia | British Columbia]]<br />
| style="background-color: #eeffee;" | Production of [http://en.wikipedia.org/wiki/Monoterpene monoterpenes] in yeast, to investigate their anti-fungal properties.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Brown-Stanford | Brown-Stanford]]<br />
| style="background-color: #eeffee;" | Mars! ''[http://en.wikipedia.org/wiki/Sporosarcina_pasteurii S. pasteurii]'' to make calcium carbonate; biosensor; cyanobacteria/''E. coli'' symbiosis.<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:BU Wellesley Software | BU Wellesley Software]]<br />
| style="background-color: #ffffee;" | (Software) Involves plasmid design, recombinases, and tuberculosis?<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:BYU Provo | BYU Provo]]<br />
| style="background-color: #eeffee;" | AND gate: OxyR (input: H2O2) + [http://en.wikipedia.org/wiki/Riboswitch riboswitch] (input: high temperature). Output via [http://en.wikipedia.org/wiki/Cre-Lox_recombination Cre-Lox].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Calgary | Calgary]]<br />
| style="background-color: #eeffee;" | Biosensor for [http://en.wikipedia.org/wiki/Naphthenic_acid naphthenic acids].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Caltech | Caltech]]<br />
| style="background-color: #eeffee;" | Bioremediation of organic pollutants, especially [http://en.wikipedia.org/wiki/Endocrine_disruptor endocrine disruptors].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Colombia | Colombia]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that recognise fungal pathogens by their [http://en.wikipedia.org/wiki/Chitin chitin], and destroy it or induce plant defenses.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Columbia-Cooper | Columbia-Cooper]]<br />
| style="background-color: #eeffee;" | Using metal-binding peptides to form [http://en.wikipedia.org/wiki/Quantum_dot quantum dots].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Cornell | Cornell]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that will lyse themselves upon receiving some specific light wavelength.<br />
|-<br />
| [[Team:Duke | Duke]]<br />
| Something to do with "increasing the robustness of bacterial gene networks".<br />
|-<br />
| [[Team:Gaston Day School | Gaston Day School]]<br />
| Nitrate detector with output as Red Fluorescent Protein.<br />
|-<br />
| [[Team:GeorgiaState | GeorgiaState]]<br />
| BioBricks from ''[http://en.wikipedia.org/wiki/Pichia_pastoris Pichia pastoris]'' promoters. Characterise with GFP.<br />
|-<br />
| [[Team:GeorgiaTech | GeorgiaTech]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
<!--<br />
|-<br />
| [[Team:Greenfield IN-Rihm-HS | Greenfield IN-Rihm-HS]]<br />
| Cadmium biosensor in ''S. cerevisiae'' (i.e. Brewer's Yeast)<br />
|-<br />
| [[Team:Greenfield IN-Schini-HS | Greenfield IN-Schini-HS]]<br />
| Arsenic biosensor in ''S. cerevisiae''.<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Grinnell | Grinnell]]<br />
| style="background-color: #eeffee;" | Secretion of [http://en.wikipedia/org/wiki/biofilm biofilm]-degrading compounds from ''[http://en.wikipedia.org/wiki/Caulobacter_crescentus Caulobacter crescentus]''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Harvard | Harvard]]<br />
| style="background-color: #eeffee;" | Improved targetting of gene therapy using [http://en.wikipedia.org/wiki/Zinc_finger zinc finger] DNA binding proteins.<br />
|-<br />
| [[Team:Hunter-NYC | Hunter-NYC]]<br />
| Removal of metal ions from contaminated water, using lipase secretion tag.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ITESM Mexico | ITESM Mexico]]<br />
| style="background-color: #eeffee;" | [http://en.wikipedia.org/wiki/Arabinose Arabinose] biosensor with (concentration dependent) output using GFP or CFP.<br />
|-<br />
| [[Team:IvyTech-South Bend | IvyTech-South Bend]]<br />
| Arsenic biosensor with output via smell. May use ''E. coli'' or ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Johns Hopkins | Johns Hopkins]]<br />
| style="background-color: #eeffee;" | Production of vitamins and minerals in ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Lethbridge | Lethbridge]]<br />
| style="background-color: #eeffee;" | Bioremediation e.g. of heavy metals.<br />
|-<br />
| [[Team:McGill | McGill]]<br />
| Control of mammalian cells using light.<br />
|-<br />
| [[Team:Michigan | Michigan]]<br />
| Bind DNA-binding protein to ''E. coli'' membrane; attach to surfaces that have oligonucleotides.<br />
|-<br />
| [[Team:Minnesota | Minnesota]]<br />
| Light-induced silicatein fused to ompA or Ice Nucleation Protein for 3D printing.<br />
|-<br />
| [[Team:Missouri Miners | Missouri Miners]]<br />
| Alteration of [http://ecoliwiki.net/colipedia/index.php/ompR ompR] system to activate at different glucose concentrations.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:MIT | MIT]]<br />
| style="background-color: #eeffee;" | Mammalian [http://en.wikipedia.org/wiki/Juxtacrine_signalling juxtacrine signalling] and [http://en.wikipedia.org/wiki/G_protein-coupled_receptor G protein-coupled receptors].<br />
|-<br />
| [[Team:Nevada | Nevada]]<br />
| Sugar production from cyanobacteria, to feed ''E. coli'' that make biofuel.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Northwestern | Northwestern]]<br />
| style="background-color: #eeffee;" | Detection of ''[http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa Pseudomonas aeruginosa]'' by using its quorum sensing system.<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:NYC Software | NYC Software]]<br />
| style="background-color: #ffffee;" | (Software) Genome analysis focusing on radiation tolerance.<br />
|-<br />
| [[Team:NYC Wetware | NYC Wetware]]<br />
| Making ''E. coli'' radiotolerant by using genes from ''[http://en.wikipedia.org/wiki/Deinococcus_radiodurans Deinococcus radiodurans]''.<br />
|-<br />
| [[Team:Panama | Panama]]<br />
| Synthesis of rhamnolipids.<br />
|-<br />
| [[Team:Penn | Penn]]<br />
| Cell-cell communication via light.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Penn State | Penn State]]<br />
| style="background-color: #eeffee;" | Radiation detector using Phage Lambda lytic switch system.<br />
|-<br />
| [[Team:Purdue | Purdue]]<br />
| Bistable toggle switch using [http://en.wikipedia.org/wiki/Phytochrome phytochromes].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Queens Canada | Queens Canada]]<br />
| style="background-color: #eeffee;" | Using [http://en.wikipedia.org/wiki/C._elegans the worm] for sensing pollutants by swimming to them.<br />
|-<br />
| [[Team:Rutgers | Rutgers]]<br />
| Bacteria responding to lasers; addition of numbers in bacteria; BioBrick validation.<br />
<!--<br />
|-<br />
| [[Team:SouthBend-Mishawaka-HS | SouthBend-Mishawaka-HS]]<br />
| Detect ''[http://en.wikipedia.org/wiki/Pseudomonas_aeruginosa Pseudomonas aeruginosa]'' and report by lux.<br />
|-<br />
| [[Team:SouthBend-Mishawaka-HS-2]]<br />
| Arsenic biosensor; report with GFP or an odour.<br />
--><br />
|-<br />
| [[Team:Tec-Monterrey | Tec-Monterrey]]<br />
| Production of high fructose syrup using membrane-bound fusion proteins.<br />
|-<br />
| [[Team:Toronto | Toronto]]<br />
| Incorporating a magnetosome system into ''E. coli?''<br />
<!--<br />
|-<br />
| [[Team:TorontoMaRSDiscovery | TorontoMaRSDiscovery]]<br />
|<br />
--><br />
|-<br />
| [[Team:UANL Mty-Mexico | UANL Mty-Mexico]]<br />
| Logic gates taking light signals as inputs.<br />
|-<br />
| [[Team:UCSF | UCSF]]<br />
| Production of biofilms with ''S. cerevisiae'', by cell display of adhesive proteins.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UC Davis | UC Davis]]<br />
| style="background-color: #eeffee;" | Mutagenesis on promoters and repressors to produce new behaviours.<br />
|-<br />
| [[Team:UIUC-Illinois | UIUC-Illinois]]<br />
| Different plasmids in a cell; choose which is active by making one go to high copy number.<br />
|-<br />
| [[Team:UNAM-Genomics Mexico | UNAM-Genomics Mexico]]<br />
| Hydrogen production in ''[http://en.wikipedia.org/wiki/Rhizobium_etli Rhizobium etli]'' in ''[http://en.wikipedia.org/wiki/Phaseolus_vulgaris Phaseolus vulgaris]''.<br />
|-<br />
| [[Team:UNAM-ITESM Mexico City | UNAM-ITESM Mexico City]]<br />
| Rubber-degrading bacteria.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UNICAMP-EMSE Brazil | UNICAMP-EMSE Brazil]]<br />
| style="background-color: #eeffee;" | Detect mammal's stress by [http://en.wikipedia.org/wiki/Catecholamine catecholamines] and [http://en.wikipedia.org/wiki/Nitric_oxide nitric oxide]; regulate it with [http://en.wikipedia.org/wiki/Cytokine cytokines].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:uOttawa | uOttawa]]<br />
| style="background-color: #eeffee;" | Improving ''S. cerevisiae'' for use with BioBricks.<br />
|-<br />
| [[Team:USC | USC]]<br />
| Countering antibiotic resistance with [http://en.wikipedia.org/wiki/CRISPR CRISPR].<br />
|-<br />
| [[Team:Utah State | Utah State]]<br />
| Production of valuable compounds using the cyanobacterium ''[http://en.wikipedia.org/wiki/Synechocystis Synechocystis]''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UTP-Panama | UTP-Panama]]<br />
| style="background-color: #eeffee;" | Various.<br />
|-<br />
| [[Team:UT Dallas | UT Dallas]]<br />
| Repair of human tissue using bacteria.<br />
|-<br />
| [[Team:VCU | VCU]]<br />
| Various projects involving the cyanobacterium ''[http://en.wikipedia.org/wiki/Synechococcus Synechococcus elongatus]''.<br />
|-<br />
| [[Team:Virginia | Virginia]]<br />
| Using ''S. cerevisiae'' to produce factors which heal human wounds.<br />
|-<br />
| [[Team:Virginia Tech | Virginia Tech]]<br />
| Fluorescent proteins that fold and degrade quickly, to be used as reporters.<br />
<!--<br />
|-<br />
| [[Team:WarrenCIndpls IN-HS | WarrenCIndpls IN-HS]]<br />
| Metal biosensor in ''S. cerevisiae''.<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Washington | Washington]]<br />
| style="background-color: #eeffee;" | Alkanes in ''E. coli''; luciferase in yeast; [http://en.wikipedia.org/wiki/Gluten gluten]-cleaving enzyme; [http://en.wikipedia.org/wiki/Magnetosome magnetosomes] in ''E. coli''.<br />
|-<br />
| [[Team:WashU | WashU]]<br />
| [http://en.wikipedia.org/wiki/Carotene B-Carotene] and [http://en.wikipedia.org/wiki/Ionone B-Ionone] production in ''S. cerevisiae''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Waterloo | Waterloo]]<br />
| style="background-color: #eeffee;" | Creation of ribozymes that will excise out of an RNA transcript.<br />
|-<br />
| [[Team:West Point | West Point]]<br />
| Detect ''Vibrio cholerae'' by letting it lyse ''E. coli'', releasing &beta;-galactosidase.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Wisconsin-Madison | Wisconsin-Madison]]<br />
| style="background-color: #eeffee;" | Biosensors to detect biofuels?<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Yale | Yale]]<br />
| style="background-color: #eeffee;" | Production of antifreeze using ''E. coli'' and a gene from the ''Rhagium inquisitor'' beetle.<br />
|-<br />
| <span style="font-size: 150%;">'''Asia'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ArtScienceBangalore | ArtScienceBangalore]]<br />
| style="background-color: #eeffee;" | Environmental mapping / metagenomics<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:CBNU-Korea | CBNU-Korea]]<br />
| style="background-color: #ffffee;" | (Software) Synthesising a minimal chromosome.<br />
<!--<br />
|-<br />
| [[Team:CTGU-Yichang | CTGU-Yichang]]<br />
|<br />
--><br />
|-<br />
| [[Team:Fudan-Shanghai | Fudan-Shanghai]]<br />
| Nitrate detection; switching between different colour production; something else.<br />
|-<br />
| [[Team:HIT-Harbin | HIT-Harbin]]<br />
| Yoghurt bacteria that stop producing acid once the yoghurt is acidic enough.<br />
|-<br />
| [[Team:HKU-Hong Kong | HKU-Hong Kong]]<br />
| Silencing specific genes with a modified histone-like nucleoid structuring protein.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:HKUST-Hong Kong | HKUST-Hong Kong]]<br />
| style="background-color: #eeffee;" | Degrading [http://en.wikipedia.org/wiki/Indole indole] using toluene-4-monooxygenase, to boost antibiotic susceptibility.<br />
|-<br />
| [[Team:HokkaidoU Japan | HokkaidoU Japan]]<br />
| Type III secretion system to inject stuff into eukaryotic cells.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Hong Kong-CUHK | Hong Kong-CUHK]]<br />
| style="background-color: #eeffee;" | Light-driven ion pump to produce electricity.<br />
<!--<br />
|-<br />
| [[Team:HSU | HSU]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #ffffee;" | [[Team:HUST-China | HUST-China]]<br />
| style="background-color: #ffffee;" | (Software?) Modification of gut-colonising bacteria to degrade alcohol; prevent drunkenness.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:IIT Madras | IIT Madras]]<br />
| style="background-color: #eeffee;" | Modular biosensors.<br />
|-<br />
| [[Team:KAIST-Korea | KAIST-Korea]]<br />
| Artistic ''E. coli'', expressing fluorescence in response to quorum sensing molecules.<br />
|-<br />
| [[Team:KAIT Japan | KAIT Japan]]<br />
| Colony-colony interaction and quorum sensing inhibition.<br />
|-<br />
| [[Team:KIT-Kyoto | KIT-Kyoto]]<br />
| Using quorum sensing to turn on and off GFP expression for aesthetic purposes.<br />
|-<br />
| [[Team:Korea U Seoul | Korea U Seoul]]<br />
| Production of [http://en.wikipedia.org/wiki/Alkane alkanes] from glucose.<br />
|-<br />
| [[Team:Kyoto | Kyoto]]<br />
| Attracting insects with light, trapping them with gum, and digesting them.<br />
|-<br />
| [[Team:Macquarie Australia | Macquarie Australia]]<br />
| "Bacterial light switch" involving [http://en.wikipedia.org/wiki/Phytochrome bacteriaphytochrome] and [http://en.wikipedia.org/wiki/Heme_oxygenase heme oxygenase].<br />
<!--<br />
|-<br />
| [[Team:Nanjing | Nanjing]]<br />
|<br />
--><br />
|-<br />
| [[Team:NCTU Formosa | NCTU Formosa]]<br />
| Temperature controlled expression; testing with [http://en.wikipedia.org/wiki/Carotenoid carotenoid], violacein, and [http://en.wikipedia.org/wiki/Butanol butanol] synthesis.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:NYMU-Taipei | NYMU-Taipei]]<br />
| style="background-color: #eeffee;" | Something involving magnetosomes to transduce a signal; also DNA for information storage.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Osaka | Osaka]]<br />
| style="background-color: #eeffee;" | Radiation dosimeter using DNA repair systems to detect radiation.<br />
|-<br />
| [[Team:OUC-China | OUC-China]]<br />
| Promotion and inhibition of bacterial strains by each other.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Peking R | Peking R]]<br />
| style="background-color: #eeffee;" | Something involving [http://en.wikipedia.org/wiki/Riboswitch riboswitches] and synthetic ribosome binding sites.<br />
|-<br />
| [[Team:Peking S | Peking S]]<br />
| Something with cell-cell communication.<br />
<!--<br />
|-<br />
| [[Team:Rajasthan | Rajasthan]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:SJTU-BioX-Shanghai | SJTU-BioX-Shanghai]]<br />
| style="background-color: #eeffee;" | Translational control.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:SYSU-China | SYSU-China]]<br />
| style="background-color: #eeffee;" | Bacteria that move towards ionising radiation and absorb radioisotopes.<br />
|-<br />
| [[Team:Tianjin | Tianjin]]<br />
| Adjusting the yeast TOR (Target Of Rapamycin) protein to aid survival in [http://en.wikipedia.org/wiki/Lignocellulose lignocellulose].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tokyo-NoKoGen | Tokyo-NoKoGen]]<br />
| style="background-color: #eeffee;" | Bacteria that absorb radioactive [http://en.wikipedia.org/wiki/Caesium caesium].<br />
|-<br />
| [[Team:Tokyo Metropolitan | Tokyo Metropolitan]]<br />
| Killer ''E. coli'' that swim to some "target" and kill it.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tokyo Tech | Tokyo Tech]]<br />
| style="background-color: #eeffee;" | Rock/Paper/Scissors bacteria; urea production; [http://en.wikipedia.org/wiki/Isoprene isoprene] for cloud seeding.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tsinghua | Tsinghua]]<br />
| style="background-color: #eeffee;" | Something involving movement of proteins.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Tsinghua-A | Tsinghua-A]]<br />
| style="background-color: #eeffee;" | Oscillation between red and green fluorescence, using quorum sensing.<br />
|-<br />
| [[Team:TzuChiU Formosa | TzuChiU Formosa]]<br />
| Conversion of CO to CO2 using [http://en.wikipedia.org/wiki/Carbon_monoxide_dehydrogenase carbon monoxide dehydrogenase] in ''[http://en.wikipedia.org/wiki/Rhodospirillum_rubrum Rhodospirillum rubrum]''.<br />
|-<br />
| [[Team:UNIST Korea | UNIST Korea]]<br />
| An organism which will kill itself upon escape from the lab.<br />
|-<br />
| [[Team:UQ-Australia | UQ-Australia]]<br />
| 24-hour bacterial oscillator.<br />
|-<br />
| [[Team:UST-Beijing | UST-Beijing]]<br />
| Bile acid sensor involving [http://en.wikipedia.org/wiki/Liver_X_receptor_beta LXR-&Beta;].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:USTC-China | USTC-China]]<br />
| style="background-color: #eeffee;" | "Self-organized bacteria"; project involves [http://en.wikipedia.org/wiki/Riboswitch riboswitches].<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:USTC-Software | USTC-Software]]<br />
| style="background-color: #ffffee;" | (Software) Visual tool for analysing dynamics of biological systems.<br />
|-<br />
| [[Team:UT-Tokyo | UT-Tokyo]]<br />
| Bacteria that respond to stress by creating a signal, which other bacteria swim towards.<br />
|-<br />
| [[Team:VIT Vellore | VIT Vellore]]<br />
| Enteric bacteria producing drugs or other compounds for the body.<br />
|-<br />
| [[Team:Waseda-Japan | Waseda-Japan]]<br />
| Responding to different colours of light, detected by CcaS and CcaR.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:WHU-China | WHU-China]]<br />
| style="background-color: #eeffee;" | Bacterial communication with light; also colour photography using ''E. coli''.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:XMU-China | XMU-China]]<br />
| style="background-color: #eeffee;" | Control of cell density with a killer gene.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ZJU-China | ZJU-China]]<br />
| style="background-color: #eeffee;" | Using different oxygen levels in biofilms to control different expression patterns.<br />
|-<br />
| <span style="font-size: 150%;">'''Europe'''</span><br />
|-<br />
| '''Team'''<br />
| '''Notes'''<br />
|-<br />
| [[Team:Amsterdam | Amsterdam]]<br />
| Make ''E. coli'' psychrophilic (cold loving).<br />
<!--<br />
|-<br />
| [[Team:BCCS-Bristol | BCCS-Bristol]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Bielefeld-Germany | Bielefeld-Germany]]<br />
| style="background-color: #eeffee;" | Cell-free biosensor for bisphenol A.<br />
|-<br />
| [[Team:Bilkent UNAM Turkey | Bilkent UNAM Turkey]]<br />
| Production of protein from algae e.g. ''[http://en.wikipedia.org/wiki/Chlamydomonas_reinhardtii Chlamydomonas reinhardtii]''.<br />
|-<br />
| [[Team:Cambridge | Cambridge]]<br />
| Bacterial expression of [http://en.wikipedia.org/wiki/Reflectin reflectins] from ''Loligo'' squid.<br />
|-<br />
| [[Team:CongoDRC-Bel Campus | CongoDRC-Bel Campus]]<br />
| Vaccine for ''[http://en.wikipedia.org/wiki/Mycobacterium_ulcerans Mycobacterium ulcerans]''.<br />
|-<br />
| [[Team:Copenhagen | Copenhagen]]<br />
| Removal of pharmaceutical products from water with [http://en.wikipedia.org/wiki/Cytochrome_P450 cytochrome P450].<br />
|-<br />
| [[Team:Debrecen Hungary | Debrecen Hungary]]<br />
| Something with Nuclear Hormone Receptors: ligand activated transcription factors.<br />
|-<br />
| [[Team:DTU-Denmark | DTU-Denmark]]<br />
| Using sRNA for post-transcriptional regulation.<br />
|-<br />
| [[Team:DTU-Denmark-2 | DTU-Denmark-2]]<br />
| A new assembly method using uracil-excision based cloning.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Dundee | Dundee]]<br />
| style="background-color: #eeffee;" | Creation of [http://en.wikipedia.org/wiki/Bacterial_microcompartment bacterial microcompartments].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Edinburgh | Edinburgh]]<br />
| style="background-color: #eeffee;" | Display of cellulases on M13 (via pVIII) or on cell surface (via Ice Nucleation Protein).<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:ENSPS-Strasbourg | ENSPS-Strasbourg]]<br />
| style="background-color: #ffffee;" | (Software) GUI for designing synthetic systems.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:EPF-Lausanne | EPF-Lausanne]]<br />
| style="background-color: #eeffee;" | Creation of new [http://en.wikipedia.org/wiki/Transcription_factor transcription factors].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:ETH Zurich | ETH Zurich]]<br />
| style="background-color: #eeffee;" | Biological smoke detector by detection of [http://en.wikipedia.org/wiki/Acetaldehyde acetaldehyde].<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Fatih Turkey | Fatih Turkey]]<br />
| style="background-color: #eeffee;" | Using ''[http://en.wikipedia.org/wiki/B._subtilis B. subtilis]'' to detect ''E. coli?''<br />
|-<br />
| [[Team:Freiburg | Freiburg]]<br />
| A cheaper system for protein purification.<br />
|-<br />
| [[Team:Glasgow | Glasgow]]<br />
| Light-controlled expression of bacteria inside biofilms.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Grenoble | Grenoble]]<br />
| style="background-color: #eeffee;" | Determination of metal concentration by growing reporter bacteria on an IPTG gradient.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Groningen | Groningen]]<br />
| style="background-color: #eeffee;" | Remember that an input has occurred; use a biological [http://en.wikipedia.org/wiki/AND_gate AND gate] to count occurrences.<br />
<!--<br />
|-<br />
| [[Team:HU-Micro | HU-Micro]]<br />
|<br />
--><br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Imperial College London | Imperial College London]]<br />
| style="background-color: #eeffee;" | Something involving [http://en.wikipedia.org/wiki/Auxin auxin], and dealing with soil erosion.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:KULeuven | KULeuven]]<br />
| style="background-color: #eeffee;" | Creation and prevention of ice with Ice Nucleation Protein and Anti Freeze Protein.<br />
|-<br />
| [[Team:LMU-Munich | LMU-Munich]]<br />
| Metal biosensors with a focus on quantification.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Lyon-INSA-ENS | Lyon-INSA-ENS]]<br />
| style="background-color: #eeffee;" | Biofilter for radioactive waste.<br />
|-<br />
| [[Team:METU-Ankara | METU-Ankara]]<br />
| Methane biosensor and methane conversion into methanol.<br />
|-<br />
| style="background-color: #ffffee;" | [[Team:METU-BIN Ankara | METU-BIN Ankara]]<br />
| style="background-color: #ffffee;" | (Software) Web based tool for construct planning.<br />
|-<br />
| [[Team:METU Turkey SoftLab | METU Turkey SoftLab]]<br />
| (Software) "BioGuide".<br />
|-<br />
| [[Team:Nairobi | Nairobi]]<br />
| Engineering a fungus to kill insects.<br />
|-<br />
| [[Team:NTNU Trondheim | NTNU Trondheim]]<br />
| Detection of bacterial stress; based on the ''E. coli'' "[http://en.wikipedia.org/wiki/Stringent_response stringent response]" which produces ppGpp.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Paris Bettencourt | Paris Bettencourt]]<br />
| style="background-color: #eeffee;" | Passing signals e.g. RNA from cell to cell via nanotubes.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Potsdam Bioware | Potsdam Bioware]]<br />
| style="background-color: #eeffee;" | Directed evolution of cyclic peptides for therapeutics. Use phage display, error-prone PCR.<br />
|-<br />
| [[Team:Sevilla | Sevilla]]<br />
| Biological circuits using multiple different genotypes at once.<br />
<!--<br />
|-<br />
| [[Team:Strathclyde Glasgow | Strathclyde Glasgow]]<br />
|<br />
--><br />
|-<br />
| [[Team:St Andrews | St Andrews]]<br />
| Production of anti-microbial peptides in ''E. coli'' to kill bacteria.<br />
|-<br />
| [[Team:TU-Delft | TU-Delft]]<br />
| Expressing mussel glue protein in ''E. coli'' to attach to stuff, with inducible detachment.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:TU Munich | TU Munich]]<br />
| style="background-color: #eeffee;" | 3D printing by immobilising ''E. coli'' in a gel; turn on genes iff 2 different colour lasers hit.<br />
|-<br />
| [[Team:UCL London | UCL London]]<br />
| Using [http://en.wikipedia.org/wiki/DNA_gyrase gyrase] to increase supercoiling of plasmids.<br />
|-<br />
| [[Team:UEA-JIC Norwich | UEA-JIC Norwich]]<br />
| Glow-in-the-dark bacteria, protists, and moss.<br />
|-<br />
| [[Team:ULB-Brussels | ULB-Brussels]]<br />
| Tools for inserting or deleting genes in the main ''E. coli'' chromosome. <br />
|-<br />
| [[Team:UNIPV-Pavia | UNIPV-Pavia]]<br />
| Regulating a quorum sensing molecule by negative feedback.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UNITS Trieste | UNITS Trieste]]<br />
| style="background-color: #eeffee;" | Synthetic biome where bacteria and eukaryotic cells depend on each other to survive.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:UPO-Sevilla | UPO-Sevilla]]<br />
| style="background-color: #eeffee;" | Biological memory with bistable toggle switches.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:Uppsala-Sweden | Uppsala-Sweden]]<br />
| style="background-color: #eeffee;" | Light-induced gene expression.<br />
<!--<br />
|-<br />
| [[Team:UTP-Poland | UTP-Poland]]<br />
|<br />
--><br />
|-<br />
| [[Team:Valencia | Valencia]]<br />
| Production of antimicrobial peptides to clean up drinking water.<br />
|-<br />
| [[Team:Wageningen UR | Wageningen UR]]<br />
| Oscillating, synchronised gene expression in ''E. coli'', and communication along fungal [http://en.wikipedia.org/wiki/Hypha hyphae].<br />
|-<br />
| [[Team:Warsaw | Warsaw]]<br />
| Cell-free cloning using [http://www.neb.com/nebecomm/products/productM0269.asp phi29 DNA polymerase]; also insertion of stuff into main genome.<br />
|-<br />
| style="background-color: #eeffee;" | [[Team:WITS-CSIR SA | WITS-CSIR SA]]<br />
| style="background-color: #eeffee;" | ''E. coli'' that search for a ligand then, upon finding it, return to a point of origin and report.<br />
|}<br />
<br />
<br />
</div> <!-- /main_body--><br />
<html></div> <!-- /mids --></html></div>Allancrossman