Team:Glasgow/PathwayTools/Pathways
From 2011.igem.org
Revision as of 01:44, 22 September 2011 by Chris Wood (Talk | contribs)
Modular Product Synthesis Pathways
Improving the Carotenoid Pathway
In 2009 the Cambridge iGEM team submitted a number of biobricks associated with the carotenoid pathway. These included the biobrick BBa_K274100 that converts FPP to to the red coloured lycopene. Lycopene is usually converted to the orange colour carotenoid β-carotene although the enzyme, crtY, that performs this role was not included in the BBa_K274100 biobrick so only lycopene is produced. The team also created the BBa_K274200 biobrick which includes the whole enzymatic pathway resulting in β-carotene. We have been working with these carotenoid biobricks to prove the principle of light controlled manufacturing. We used BBa_K274100 to produce lycopene under control of a light dependant promoter. Using another light dependant promoter it would be possible trigger the expression of just the CrtY gene to selectively convert the lycopene into β-carotene. The 2009 Cambridge iGEM team did not include a biobrick of just this step in the pathway so we amplified it using PCR and added biobrick ends. This pathway could now be controlled by light, to determine which product is synthesised. |
Figure 1: β-carotene synthesis pathway. This figure shows how the simple molecule IPP is converted to β-carotene through a number of enzyme catalyse reactions. Image from Beyer et al, 2002 "Golden Rice: Introducing the ß-Carotene Biosynthesis Pathway into Rice Endosperm by Genetic Engineering to Defeat Vitamin A Deficiency" The American Society for Nutritional Sciences J. Nutr. 132:506S-510S. |
Forward Primer | 5' - GAATTCGCGGCCGCTTCTAGAGAGGAGGATTACAAAATGCAACGCATTATGATCTGATTCTCG-3' |
Reverse Primer | 5'-TGCAGCGGCCGCTACTAGTATTATTAACGATGAGTCGTCATAATGGCTTGC-3' |
Opiates Pathway
This system of light controlled product selection can be applied other metabolic pathways to create useful products from a common precursor. The therapeutically useful derivatives of morphine is would work well with this system allowing the light based selection of a number of products from a common precursor.