"

From 2011.igem.org

Pathways

Improving the Carotenoid Pathway

In 2009 the Cambridge iGEM team submitted a number of biobricks associated with the carotenoid pathway. These included the biobrick BBa_K274100 that converts FPP to to the red coloured lycopene. Lycopene is usually converted to the orange colour carotenoid β-carotene although the enzyme, crtY, that performs this role was not included in the BBa_K274100 biobrick so only lycopene is produced. The team also created the BBa_K274200 biobrick which includes the whole enzymatic pathway resulting in β-carotene. We have been working with these carotenoid biobricks to prove the principle of light controlled manufacturing. We used BBa_K274100 to produce lycopene under control of a light dependant promoter. Using another light dependant promoter it would be possible trigger the expression of just the CrtY gene to selectively convert the lycopene into β-carotene. The 2009 Cambridge iGEM team did not include a biobrick of just this step in the pathway so we amplified it using PCR and added biobrick ends.

Forward Primer	5' - GAATTCGCGGCCGCTTCTAGAGAGGAGGATTACAAAATGCAACGCATTATGATCTGATTCTCG-3'
Reverse Primer	5'-TGCAGCGGCCGCTACTAGTATTATTAACGATGAGTCGTCATAATGGCTTGC-3'

Opiates Pathway