"
Team:Glasgow/PathwayTools/Pathways
From 2011.igem.org
(Difference between revisions)
Chris Wood (Talk | contribs) |
Chris Wood (Talk | contribs) |
||
| Line 13: | Line 13: | ||
</td> | </td> | ||
<td> | <td> | ||
| - | <img src="https://static.igem.org/mediawiki/2011/d/db/Carotinoidpathwayglasgow.jpg" width="100%"/> | + | <img src="https://static.igem.org/mediawiki/2011/d/db/Carotinoidpathwayglasgow.jpg" width="100%"/></br> |
| + | <b>Figure 1: β-carotene synthesis pathway.<b> This figure shows how the simple molecule IPP is converted to β-carotene through a number of enzyme catalyse reactions. Image from Beyer et al, 2002 "Golden Rice: Introducing the ß-Carotene Biosynthesis Pathway into Rice Endosperm by Genetic Engineering to Defeat Vitamin A Deficiency" The American Society for Nutritional Sciences J. Nutr. 132:506S-510S. | ||
</td> | </td> | ||
</tr> | </tr> | ||
Revision as of 01:26, 22 September 2011
Modular Product Synthesis Pathways
Improving the Carotenoid Pathway
|
In 2009 the Cambridge iGEM team submitted a number of biobricks associated with the carotenoid pathway. These included the biobrick BBa_K274100 that converts FPP to to the red coloured lycopene. Lycopene is usually converted to the orange colour carotenoid β-carotene although the enzyme, crtY, that performs this role was not included in the BBa_K274100 biobrick so only lycopene is produced. The team also created the BBa_K274200 biobrick which includes the whole enzymatic pathway resulting in β-carotene. We have been working with these carotenoid biobricks to prove the principle of light controlled manufacturing. We used BBa_K274100 to produce lycopene under control of a light dependant promoter. Using another light dependant promoter it would be possible trigger the expression of just the CrtY gene to selectively convert the lycopene into β-carotene. The 2009 Cambridge iGEM team did not include a biobrick of just this step in the pathway so we amplified it using PCR and added biobrick ends. |
Figure 1: β-carotene synthesis pathway. This figure shows how the simple molecule IPP is converted to β-carotene through a number of enzyme catalyse reactions. Image from Beyer et al, 2002 "Golden Rice: Introducing the ß-Carotene Biosynthesis Pathway into Rice Endosperm by Genetic Engineering to Defeat Vitamin A Deficiency" The American Society for Nutritional Sciences J. Nutr. 132:506S-510S.
|
| Forward Primer | 5' - GAATTCGCGGCCGCTTCTAGAGAGGAGGATTACAAAATGCAACGCATTATGATCTGATTCTCG-3' |
| Reverse Primer | 5'-TGCAGCGGCCGCTACTAGTATTATTAACGATGAGTCGTCATAATGGCTTGC-3' |
